Description :
From Genome Similarity Track
Location :
Scaffold_306:9823- 12463
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_306-abinit-gene-0.26Oligopeptidase A
Pytap_DAOMBR444maker-pag1_scaffold_306-snap-gene-0.16Oligopeptidase A

Sequence
2640 bases(100 bases per row)
CTTGGCGAGGCCGTATTGGGTCAGCAGCGGCACCATGGACGGCTTCCGGCCGCGGAACGCCTCGAAGACTTGAAGCGGATGCTCGCCGCCGCCACGCCCC
AGCACCGTGGCCGCGAACTGGCGACCCACACGCGCCGCCTGcGACGATTCCGGTGCGGCACCCGACGCCTCGTCCGCGCGCAACGCCTCGTCGAACGCGC
CGTAGgCGTCGCACGACAGGATCTCGGCCCATTTGTAGCTGCGCTCCAGTCCAGAGGTCAGCCCAGTGCACTGCCTCGTCCGCAGCTACGCGCACGcNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGGCGTAT
CcTCcGGCGAAGATGTGGCtGAACGAGCACAGGAAGCGATCCTCGTCcAGTGGTtCcATgACGgAGTACCTACCACACACATgaGTCACAATATTGGACG
AATCATTCGAAGGATTTGCTGTGACGTACCGTTGGAGCATCCGCTTCTGCACATCGAAGAGCGGCTCTTGgCCGTCGTAGCCGTGGTGGAGGTGCATATC
AAGTGCACCAAACGCTAGCTGCCGCAGCATTTGCGTTGCCACCATATAGTTGCGCGCCGATTTGATTTTCTCGAagAGaTtCAGTTGGAAGTGCTGCACC
CGTCTCGTAGTGACCGCTAATCGACTTGAGCGTCTTCTCGTCGTAGCAGAAGTTCTCCATCATCTGCGACGGAATCTCCACAGCATCCCACTCGATGCCG
TTGATACCAGCGACTGCGTTGTAGTCTACCTTAGTCAGCATGTGCTGAAGTCCGTGACCAAATTCGTGGAAGAGGGTCTCTACCTCACGGAAGGTCATTA
GGCTTGGCTTGTCTCCCACTGGAGGCGACTGGTTGCAGATCAAGTACGCCACCGGCACGCGCAAGCCGTTACGGTcTGATGGTCCCAACAATTTGCTGCG
ATCTACACAGACGTTCATCCACGCGCCACCATTCTTCTCCTTTGGTCGTGAAAAGGGATCAAGATAGAAACCAGCGATGATCTCCTTGTCTCCGTCTTGG
CTGCGCACGTTGAAGAAACGCACGTCCTTGTTCCAGACTTCGGCCTGGCCGTCCGCAGCTTCGATGGTCACACCGAAGAGCCTACTTGTTAGCGCGAAGA
GGCCCTCGAGCACCTTCTCAAGGGGGAAATAGGGCTTGATTTCTTCGTCCGTAAAGAGATACTGTTCTGCCTTcAGCTTCTCCGACCAAAAGCCGAGGTC
CCACGGGGCAAGAGCTTCCCTCTGGCCATGCTTCTTGGCGTACTCCGTCAACACACGAATCTCTTCTTTGGCCATTTtCcAGGCACTTCTCTCGTAGCTC
CTCGTGCATCTTCTCCACCTCCTGCACGCTTGGTGCCATTTTCTTAGCCAGACTGACTTCCGCGAACGTGTTGAAACCGAGTAGACCTGCCATTTCCTTA
CGGATGGCAAGGATCTCCTTGATGATTTCTTCGTTGTCGTACTGACTACCGCTGCTAGCaCGGGTAATGAACGCACGGTGCAGCCGCTCGCGTAGATCGC
GGTTCTCGGCATACTTCATAAACTGCACGTAGGAAGGGGGgTCGAGCGTGATACGCCACGGACCATTCTCAGGAGTCGATTCTGGGTGACCATTTTCACG
CGCACTTTGCGAAAACAACTGGAAGAGCGAGTCTGGCAGACCTCGGAGCTCGTCCTTGTCTCCCACGATAAGCGAAAAAGCCTTCGTCGCATCCAGCAGG
TTGGAGGAGAACTTGGTGCTCTATCGTAGCACCTCATGAGTGGGTAATACATGAGGACGAGTATGACGCATGAGTTACTTACCAGCTCCGCTGCACGAAG
CTTgaGCTTGTTGAATCGCTCTTTCTCTTCTCCCTcgAGACCAACACCACTGAGCTTGGCACTGCGAAGGCTTAGCTCAATCACGCGCTAGATTCGGAGc
ACATTAGTCGCTTCAGTGCCATTCTAATGAGGACCACCCACAaTGATCTTCCTACCTGTTGAGCAAGCGTGAGCGATTCCCACTGCGCGCTGTTGCGCAC
TGCCTGGTACGAGTCGTAGAGCGTCTTGCTCTGAGACGTCTCAGTGAATGTTTGGATCACAAGTTGCTGTAGCTGGTCGTGAACTTCACGCAGTTCGTCC
GAGTTCCGCACACTCATGAGGTGGCCCACAACGCCCCACATGCGTTCCAGTGGGTCGCTCTGCAGTTCCAACGGGTAGACAACGTCCTCCCACTTCACCT
CAGGTAGCGTCTGCTGCAGCTTGGACTCGAGCGCTCGCAGATCACGCGTGTAATCCGCGGCTGCAtcTTGACTGCTGGAGAGATATGAGCGATCTCCAAC
CGTTCGAAAGGCGGCAGTGTGCGCGCTTCCACGCACTCTACCAGAGGATTGGCCACTGCACTAGACAAGCcACGCCATTGGGTCACACGAGcaTATCGAg
tGGTGCGAGGCAGCGCGCTAGCCGTCAcGAGGGCGGCGCG