Description :
From Genome Similarity Track
Location :
contig_36:98227- 103807
Transcript NameFunction/comments
g8753.t1hypothetical protein

Sequence
5580 bases(100 bases per row)
TAACAACGACTCGACGTATTCGTTCTCCATCGATACAAACCAGTCGTACCGCGCATCAAACTGTTTCTCGTACTTGGCTTTGCGATGTGACGCCTTCTTG
TGGTAAGCCGCCCACACCTCGTGCACAGTTTCCTTTGTCTCCAGCAGTGTGTTGATGAATATGCGATCCAAGTTATTCTCTAGTTCCTTTAAGGGTGGAC
CTACAAGCTCCAGCCACTTGGAAAACTTGATAAAGGGTGGAGACTGCACAATGCACCCCTCTGTAGGATTGTTTGATATTCTACTGCATTCCAACAACAC
ATCGAAGCCATTCTTCATCAAGTTTACCGAATATGGTGGCGCCCCCGTTTTTCGTATCTCGACAGTCAGTAATTCAGTTGTACATGCCCGCTGACAGATC
ATGAGATCTATCCAAAGGTGTGCTGCCGCCTCTTGAAGTGATGGTGAACTCGAGTCAGACAGAAGTTGAAGTAGGTACCGGCACAAACATGAAACAAATG
TTATGTCTTGGTTGGGTTGTGAACCGAGAACAACTTCGCGGTGCGTATGAATCTGCTGCAGCATGGCTTCGAGCTCCTCGTCTCCAACTTCAGCGCCTCT
GCCGTGAAAAACGTGCAAAATCACGGCATTTAGCGCTTTGTACAGCTCCGACAGTAAGTTTTCAACATCTGCAGAGCGGGACATATTCATTCGACCCATC
AACTGTCGAAATGGACGTCGCGTTTTCCCTTTGTTTAGCTTTTCAGAAAGCATTTCTCCAAATGATGAAGGCGAAGGGGCCGCGAGTGAAAAAGAACTAC
TCCCGTCAATACCAGCAAGCCCGACAGTCGTTCCACTCAGTACAAAAAGAACCAGCTCTAGTAACCGAGACGGACCACCAAGGAAATGTGCTCGTCCACA
GCAAGCAAATGCTGGCGGGCAACCATCGCCATGTTGTGCTCTTTGCCAACTGTGCATCTTGTCAACTACAAATTTCACAAACTCGCGCACATTTTCTCCA
AAGTGCTTGTGCTTCACCAAAATATCGTCATCGTCAAACTTTGCTCGTATGTGATCAAGAAGACCCATCACGACAAGGCTCTGGAAACGTAAGAGAAGCC
CACTATGTAAAGGAGGAAGCACGACTGATGAGCTCACCGTGCCATTCACATAGTCTTCGACAAGATCATGGCCGTTTGGAGCGTCCAGTAGAAATTTCAT
CAGCAGCGCAATTAACAGTCGCAGGCCACGCGCTGCAACCGTATGGTGCAAAAATGGGTCACTTCCGTTTGAGTCCGCTGCTGCCGCCTCCTCTGCCAGC
TCTGCTCGACCTACATCCACGCTATAATCAGTCACGACAACTTGTTTGTCCTGCAAAACTTGAATAATGTGTTCACGTGGATACGGATAGTGCACGACTA
AGTAAGCTCTCGCGGCCGCGCAAATCAACCGTGTCAACTCCTCCATGAACTCCAGCCGCATTTTCTCACTTCCCGACAAAAACAAGGCGTGCAAACTTGG
CATACTTTCGAAAATGTGCTGCAGAAAGTCGAGAACTTCAAGATGATAGATGTCGGTTTGATCGAGCAAAGTTGGCGGCACTGTTGTAGAAGGTTTCACG
CCATCTTGCTCCATTTTGATGCCAGGGAAATGTTCTTGACTCATCGCAGTAGATGTTGACTCATCTGTGGAGGGCTCCCCAGTGGTACTCACCATGGCCA
CAGGATCGTTGAAGTGGCGGCGGAGCAATATCATAATTACAATCAAAATACTGGAATTCACGATACGATCTCGCTGGACGTTCACTTCAAAATCCTTGTC
GAGGTATTCATTGTCAAGTCGAATTTCATGAGGTATGCCATCGATCGGTGGCCCCAAGAGCGCACTGAATAGAGCGTACCACATCTTCTCGAAGGGGAAA
TGCATCACGTTTGAATTCACCGCGACATTGCTGAAAACCGCGTGATTACACGGTAAACCCTGAGCCAACAAGCGATAGTACCCCTCTTTCTTGAAAACAT
TTTCGTATCGTGGATTTCCAAGCAGCGTGCACAGCAGTCTCAGCGCTGCAATAACTGTTGATGGAGTAATACCAAATGAAAATTCGGTCTCGTCACCTGG
AAATAGGAAATATTCAATCCAGCGTAGACCCAGATACTTACGGAAACCTGTCAGTCGAGTCGCGCTTGGTAATTGCATTCGTGAAGCTCCAGCACCACTC
GTGTTACTTGATGCAGCAGCCATTTTGACTGCATTGCTAACACCCAACTCTATTACTGAGCTGTCCGGATCATCTTGGTAATCTTTGCTTTCCTTTATAT
CCAGTTTTTGCACCGCCTTCAAGAGTGTTTCCAATAGAAGCTCCTGGATCTTGGCTTGATGCGAGATTAAATGTGCATTTACCCACTTTGTAGGGCCAGG
CTTCAATTCTGATACCTTTTGCCCTTGCTGTACGTTCCAACAATTACGATCTATTCTTTGAGAGCCCCTGGGACTTAGGCACAGTCTAGCTGTAGGACTC
GCAAGGGTATGCGCTTTAAAACGAGCACCATCTTCATCGCTTGCGTTGCGCCTTTCATCGTCTTCTTCCACAATGATTTCTTCTTCGGCAGCTTCTCCCC
TGTAGTGGCCAAAGCGTGGAGACAACGTGGCTGCAAGGAAGCTCGTTACGTCTGCAAAATTTGATTCCACAGTTGACTCACGATTGGGGCTCGTCAAGCA
AACCAATATTACGTCTACAATAACTCGTAGAAGATCGACCGTGACGGTTGCATCCATTAGAACGTAAAGTAACTGCCGGATGAAGCTCATTGATTGCAGC
TGTGCTCGATTTCGTTCACGAATCGCCTCGTCGTCAGCAGCCAAGCACGAGTAAAGTGTTGAAAAGAGTACCTTTGCAGTATCCACACCAGGCGCCTTCT
GCCAGAGTGAGTAGTCCAGAACAAAGTACTGCAACGCTTGCACATTACGGATCGCACTGTCCGGGGAAATTTGAGCTATCGTTTCCAATTGCCGTTCTGG
CTTCTCTAGCTCGATTTCCACACCAACAATACGAAAAATAATCTGTAGGCATGTGGTGTTTAAAACGATGCCTTCTTGTGTAGAAGATAGTTCACAACGC
CATAGCCATGATCATACTCCATCGCTGCCAGATTGCGCGAGTCACCTTGCATGAAAAGCCAGAGTAGACTGAGAGCCAACTCCACTTCCTCGTCTGTCGA
AGCTTCGTCTAGCAGCCCGTACGCAATTTGACACCCAGAGCTACTGATGTCGAACATGGCAGATGCCATTGTCGCGGCCTCACACAGCACAGTCCCTCCC
ATGAGATGCCCACTTGGACGACCATCAAGCCTACTGTTGGGAATAATCAGCAACTCGTTCGCTACTCCATTTCTGGCTGAGTATGCCACGACAATCCTTT
CAGACGGGACGGGAAGATGGATCAATGGCACAGCGCTAGGAATGCGAGAAAAGACGTTAGCACTTAACTTGATATCCTGGACGATAGCTGCAGCCGTACT
CGATGCAGCTGAAGCAAGCGATAAACTCCGGCGGAGAAGCTTGTTACGCCCACTACGCTCAACATCGACGGAATCGATAAGCGACCGAACAGGGTCCCAC
ATGTATGAATCAAGCACCTCCATGTTCGTTATGCTCAGATGATCAAATGTAGCCGCGATTTCGTTGTTTCCAGCAGCGCCGAAGAATAGCCGGTCGTAGG
ATGGCCCCGCTGCGAACACGGCATTAACCACTGGCGCCGAAACTGGTAGGTCAAGCAAGTAAAATGGCCCTACCATCCATCTCACACTGGAACACCGACG
AGCCTGAGATGGCACGCCTACCAGCCCACTTAGTGGCTGGCTGCCCGAGATGCTGGACGGATATGAAATCTTTACATTTTCCTGCAAAATCCCATTCAAG
TAGCAGGAACCATGCTGGACTGGAAGCGCTGCTTAGCATGAGTGAAAACGACGTGATGCCATTGCCTCGTCTTGATTGGCGTATGCGAAAATTGGTAGAC
TGAGGCGCGGTTTGAGCTCGTTCGCATGTAAAGCTTCCCTCCTTTTAGAAACGCTTCACTAACCGACTTGCCGTCGCTTGAGCGAAGTCGAAAGAGATAG
AACATTGGTGGATTGCAAACGACGCACTCACCGCCACTGTTCAGAAGCGCCTCAACACATCCTCGGCACGCTCGGTGGGAACATTTCAATACATACTCGT
CCTGCACTTTTCCGCGGCAATGAATGCACGTGTTCGACATAAAACTCTCGGTATAGCTTCTCACGCTCCTCTTTTCGTTCAAACGAATCCACTCGAAACC
ATACCATGACCGAGTATCCATCGGGTGGAGGCCAAACTTTAGAGTTATGTGAAAAAGTTGATAAAGATGGCGCAGATGTACCAGGCTCGATTGAAGACGC
AGACCTGGCATTGATATCGGGGATTTGAAGACATCCGAATCCTTCCCTTGATACGTCAAACTCAATGGCAGGCGCTCCCTGTGTGTGATCAAATGTAGCC
GAAGTCAACTTCAACAACAGTCTCATCAAAGTCGGAATGGGGGTTGCAGGTGCCTCCTTCGCCAAAACGGGGGTGCTCTCCTTTGTTGTTCGAGAATCCA
TAGTTTTTTGCACTCTCGACTTCAATCGCGACAAATGTTCCGCCTTCCTCCATTTTGTAGACTGTCGTCGCCGATCGCGGCACAAAGACATCAGCATTTT
AACCCAGTAGTTTGCCGCTGATAGAGAAACACTAGCAAGAGCGACGTTTTCTACAAGAGAAACAGCGAGTTCATGAAACGGGTTGCTTTCCCACAGCAGT
GCTTGTGAAAGCAAGCTTTCGTTCGACTCGAATAATCCTTTGGTGTTGCGAGATGCTGCCGTAAAGGATTTCAGCAAGATCTCTAAAATATTAGCAGACG
CCAGGCGATATGAGTTCCCGGGGCTGAATCAGCACACAAGTGTCAGTTATACACCAGAGAATCGAATCAGCAAACACATGGGCAGTGAAAGCAGCTTTCA
CGTACACTGTCGAAATACGTATGAGGACGCCCATCAGTTGTCGTGTAGAATTCATATCGAGCTCTCCAGCCCAAAGACTCATAAGCTGGATCGCAACAGC
AAACAATTGAGGGTAGCGCAAAGCAGCCGAGCAACATCCATCTATCGGCAGTGTCGAGGGTGAAGAAACGTTTCCGCCAAGACAAGTCATCTCATAATCT
CCCACTGAAAAACCAATACAGTAACAAACACAAAAAAAGACGAGTGCATCTGCTTCCAAAACGTCACCACCGCTGCAGTTTTGGAAGCATTCCTTGCTAC
GGATCCATTTTTGTAGTGCGAGAGTAAGCTACCGATTAAGTCACCAAAGGTACCGAACGAAATTGAGCTGGAATAACAAAATGGTGAGTGTGAGAAGCAG
GACGGAGTACTACTCAAGAAATCGTAAGCGATGCATACCTGAGAAATTGTCGCTCCGCTTCCTTGTTAGTCGTAACAAGAGAAAAAATCGACTGCAGCGA
CAACACCATTGCAGAGCGAGCGTTGTCATCATCGACGTCGTTAATAGCGCCAGCAGTAACCTCCCACTTCTTTGCCACCG