Description :
From Genome Similarity Track
Location :
Scaffold_42:98222- 101355
Transcript NameFunction/comments
Physo_135962reverse transcriptase

Sequence
3133 bases(100 bases per row)
GCTCGATAACTGTCTGTGGGGCTTCGTGCGACTTCCGCCCTGCGAGGAGGTCCGAGTTGATCCCTGGATGTGCTGGATTTCCTAGGAATCGAGGTGGACG
ACTCCGCTAAGGAGGAAGAAATCCCGCCTCTGTCTGAGGAGAATACCGTGTCCCGGCGAAATATTCCGGCCCCGCCTCAGCTGAGTCCTGTTCTGGGGCG
GAGCTCCTACATCGATGACATCGCGTATGGAGCAGAGACCTGGGACCAGATGTGCGAAGTCTTGGACCGGTTGCTTTATCGACTGAGGTACGGGGGGATT
TCGGTAGGCTTGCCCAAGAGCGAGTTTGGCAAGAAGTCTATCTCCTACCTCTCGCACGAGATTGGAGCTGAGGGAATCCGAGCCAAGCCGAAGATCGCCA
AGGGAGTCAAGGACTTGCCGTTCCCGTCGACGCTGAAAGGAGTGCAGTCATTCCTGGGGAGTCTCAATTACTACAACAAGTTTATTGAGGACCTCCCGGT
TGTAGCGTCTGTGCTCTACGAGTTGACGGATGAGCAGATTCAAGCTGGACGTGATCTCGGCCGAGCTGAGGAGGCGTTTGAAATCCTGAAGCAGAACATT
GTCTCTACCCCGCTGCTCAGACACCCGGACAGGGAGAAGCCGTTCGTGATTATTCTACACGCTAATCCCTGGGCAGTCTGTGCGGTGCTGGGCCAAGAGT
ATGACGGAGTAATTTTCCCGGTGCGATACACTGGGAGGGCACTGCATGATCAGGAGCTCAGATACCACCCGGCTGAGAAGGAAGTCGTAGCGTTGCTCCG
GGTTCTCAGAGTCTTCTATTCGATGCTGAGCGGATGTAAGCTGCTGAAGGTCTACACCCGGTACTCTGTTCTGAAGTGTTTGTTCAAGTCTCGATCGCTG
GGGGGACGTTGTGAGCAGTGGGCTGCACGGCTGTCGCCCTGGCCTTTGGAGGTTCAAAAGGTCGAACGTGATGAAGATGGTTTGGCCGCGGTCATGGGAG
TTGGGATCACCCCCCGAGACCAGTTGGACAGGATCGCTGAGAACCTTATCCCAGATAAGGGACGAGTTGTCCGAGCCCCACCGATCAGCCTGGAGATGCT
GGAGGCGGGCTACGAGGGGTGGCTGCTCAGTTTCGATGGAGCTGCCAAACGCTCAGACCGCTCTGGTGCTTCTGGTTGCATTCTGTGGAAGCTCCCGTCC
TGGGACGTGGTCGAAGCTCGAGGTTTCCACTTTGAAGGCATTACGGTGAATGATGCTGAGTACCATGGTTTGCTCGAAGGTATTCGCATGGCAAAAGCTC
GTGGCATCTCAGACCTTGTGGTGGTCGGTGACTCTCGGATTGTTATTCAGCAAGCTCAGGGTTTGATCCAGTGTCTGAGCCCAGGACTGCAAGTGCTGCT
GGCTGAGTTCGAGACGCTTCGCCCAGAGTTCCAGCGATTGCGCTTGGTGCATGTGAAGCGTGAGTATAACGCAGCTGCGGACTATCTCACGTCGAATACT
CTGGTCATTCAAGGTCCCGTCGCTATTGAAGACCCGGTTGAACTGGTTCAGCTCAAGCAGCTGAATCGGATCCCGGAGAAGCTGATCAAGGTGAATGAGG
CTGAGTCTGCTGAGCCTGAGACGGAGCAACCTGACACTCAAGCTGATGTAGAAGTGGTGGCTAAGCCAATTCCACTGGAAGATGCTGCCAAGCCCCTGTT
GCCCAGCGCTAAGATCTTCGTGGTGACTAGGAACCAAGCTCGGGCCAGGGACGCTGAGACTACAGCAACCAGGGGCGACTCCGACCAAGGTATCGATCCT
GACCAGAATGCTGAGCCCCCCGCTGAGCAAGCTCCAGTGTACTCACCTGAAGCAGCAACTCCTGCTGCGTCAATCGTTGAACGATGGAGACGGATCCTAG
TTCTGCAAGAGGCTGAGCCTTGGACGAAGAAGCTCAAGGATTATCTGAATGGAGACTTGGGGAACCTCTCCGCTACTGAAGCTGAAGATGTGGTCAAGAT
GATGGATCAGTTCACCCTTGATTCGAGAGGAGTCCTGTACTATCTGAGTCGAGCTACTCCGGTAAGGCCTAGAGACGCAGTTGGGAATCTGAGATTGGTT
GTGCCAACGGCGCTGAGAGATGACTTGCTTCAGCTCAGCCATGAGGAGTTCCAAGGTGGTCATTAAGGGATCACTAGGACCTTCGAACGACTGCGCAGGG
AGTACTACTGGCCGAGGATGTACGCGGATCTGGAACGCTATGTGAAGGAATGTGTGGATTGTGTCACTGCCAAGGGAGCTCCGCCCAACCCTGGGCCGTC
GCCGGGAAACATTTTGGCGACTAAGCCCTTTGAGGTGGTCTCTATGGACTTCGTTACGTATCTACCCAAGTCTGACCGTGGAAATGTGTTCCTGCTCCTG
TTCCAGTGCGCATTCTCAGGCATCATCATGTGCAAGCCGATGAGTCTAACCACAGCTCAAGATGTCGCTGAGGCCTACATGGAGTGTGTGTCCCAGAGGT
TTGGTGCGAGCTCTCTGCTCCGCCATGACCGTGATCCACGTTTCATGAGCGAGGTGTTCGCCAGGTTCCGCGAGATGCTGGGAAGTCGGCAGCGTGCGAC
TCTGGCGTACAGACCCCAGGCAAATGGCCAGCAAGAGCGATCAGTGCAAACAGTGGTCCGAGCCATCCGAGCGTACGTCGCTGAGCCAGATCAGAGCGAC
TGGGACGACCAGGTGGAGAAGTTGATGTGGGCTCTGAACACGACTTTGACGCCACCCGTCTCGACACGCCGTTCTACCTGGTTCACGGCTGGGACCCTCA
TAGCACTGTTTCGGCCATGCTGGGGCCATCTCCGACGGGCTTGGATCAGAGGACTGCTTATGAGTGGCGTCGCAAGACTCAGCGCGAGTACGAGTACGCT
CAGGCCTGGGCTAAGGATTTACAAGCTGAGGCCAAGGTAAAACGCTCGGCTGCTCAGACAAAAATCTGGGCTGAGTTGTCTGAAAGACTCAAGAAAGGTT
TCGAAGTTGGTGATGCCGTGTGGCTATACCTGGCTCGAGTGCAACCTGGGCTCACGAAGAAGTTCGCTCACCTCTGGCACGGTCCGTTCCGGATTCTGGA
GACCTCAGATGACTTCCGATGCAAGCTGAAGAT