Description :
From Genome Similarity Track
Location :
Scaffold_76:9820- 12842
Transcript NameFunction/comments
Phyra_82685reverse transcriptase

Sequence
3022 bases(100 bases per row)
GTCCTCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAA
GTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACG
CCCGTCGTAGACACTGTCTTGTCGTCGCTATGACTGCGCGCAGTACGTGCGCGAGTCGTTACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTT
GTTTCGATTTAACCGGATACCCTCCCCCACTTAAGGAAGAAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGG
TGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATG
GTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGATGATCCGCAGTCGACATGGACAGCTGTGTCCCAAGAAGTGTAAACACTT
CTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAAACATGCCGT
CTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGGTACATCTTGCTGAAGCGGTCAACAAAGACCACTATACCAGTCCTCCGCTTGTTGTCTTGC
GGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGC
GCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAGTAGAAGTCACGCGTGAGAAGTAGATATGTCTTCTCACGGCC
AGGATATCCCGATGTCGGGGCATCGTGGTACTCGTATGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACT
GCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTAGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGA
AGTACTCCAACAATTGCTTCGCATCTGCATCATGTGCGTATGCGCCTTTCACGTCATCCAACAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAAC
TGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTG
TATTCCGCAAAGAATGACAGCCACCGTGCCATTCTTTGGGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATG
GTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAG
CTGACGCGATTGGTAGTAAACCACGCGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACCACGTGG
AATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCATG
CAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAG
TTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGT
ATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCA
CATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCT
GTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTC
TCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGTGGTATCG
GCGTCTGGGCCGGTACCGTCGCATCGTTCAGCTTGTTGTAAGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTG
CGGGGACTTCGATTCCCGCACTTGTCCTGCTTTGCGACAACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTG
ACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTATCCTGCGGTAATTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACT
CACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTC
AGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCG
AAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTTGTAC
GCGTCAAGACACTCAATGTCTC