Description :
From Genome Similarity Track
Location :
Scaffold_2754:982- 2969
Transcript NameFunction/comments
Phyta_totarag14801hypothetical protein PHYSODRAFT_330603

Sequence
1987 bases(100 bases per row)
CTCAACTCAAGATCCCGCTAAAGGAAGAGTCATACACCCGTACAAGGCACTCCAGGCCCAGATCGAATCTGGCCTTCAAGTCGCAATCTCGACGAAATTA
AGATCGATCGCAGACTTGATCCCCAACGgcccagcgtgaagaagtttccgcgctgctgccgtaAGTTCCCGCTGTCCGCCAGACAGTCCAAGacctcagc
accaagcgtctcctccgagatcacccgaagagcgatcccgccctaccgacgggtacacaaggtgagcaaggttcaactatcccacggatatcggagtacc
ccctccgttagtcggcagttcgggcgccgtgtgtgagcGGGACCTGCGATCTTAAAAattcgcagacccactacaccacaacggtgcgcgtgcccggGTT
TTTGGGTGACTCGGGATTTCACCGTGAGTCCCTCCAAGGGGAAGCGCAAGCTGAGAAAGGACCAGGGAAGCAAGCGTCGACGGCGACCCGAtcgccgacg
acgccgctAAATCAAGATCGATCTGCGGATCGACAGAGTTTTGGGAGGAGCTCTACCGACGGAACAGAGGAAGGTCCGGCGACGGACTACGAAGATAAAC
CTCAACCTCCTCCCCAGGTCCCTTCGGAGACCCGCGGGGGTCTCGACGCCAATCGAGACCCGCCCGATGAAGGACCACCAGCGAAAGCTGGAGGTACTTT
ATCCACCCAACCGCCTGGCCCAAGATCGAGAGCAAAAAAGAAGTCGGCGAGATCGAAGTCCTCGCGtaagaagatgaaggcccCGGACTCCGACATGCGA
CGATCCTGCGTCAGTCTGGACCGATAAATCGCTGGAAGACGCGTACTACAGGAAGAATCTTCACGATGTCCTGATGCAGAACCCCGTGATGATGATCCAT
CGTCCGAAGATCCTCGGTGATCTCAAGGGCCCCGTGTCTGGACCTGCCGCCGGATCAAACAAGCTGGAAGCagtgaaggagctgctccaactgctgGAAG
AATTGGGGATCGTCGTCGGTGCTTTTGAAGTCAAGAATGTTTTTGATCTTAAGCTGAGCGTGATTAAGCATGCGCTCCAGACGCTCTTcgcgacgctgaa
gcagatggTTGGTAGGCTTAGCCAGCCACCGAAGAAGTGGACACGGATAGCGCCGGCGACCCACCACGAATGACGCTGGGACCGTCCGGCGCAGCCATGT
TGCGAGATCGAGCTCTACGCGCCGAGCAAGTCGCTGAAGCTTCTATCCACGATACGAagattgcagcagcaagcctGACGCGCCACTCGCCCGATAGGCT
GGAGTCATATTTCCAAGCGGTGATGGGACGCTTTCTGAAAGAGCAACAGTCGCCTCCCAACCTTCGAAGTACAAGGCCGACTGGAGATCAAAATGTGGAA
ATGGAGTCGGTTGGGTCACCAGACCACCACTCCTCGCCATGGGAGTATGACCCCGACGATGTTGATCTTGCCACGTTCGCGCGCGCAGCAGTGGCTTCGA
CTGCGACTTCCAGAAAACCGACGCCTGCTCCTAGCATCCGTGTATTGGCGATGTCTGAACTGAAAGCGCTCGCCGCGAAAGATGCTGACGAAGACCGAGC
TCGATCTTGGCTAGGCAAGATGAAATCAGCAGTTATCCGAGATCAAGCACCCGATGAAGAAAAGTGCTTGGTTTTCGGCGATCTCCTCACCGGACCAGCC
CGAAACTGGTACCGACAACTGAGTCGCACGACGCATAGTACTTGGAAGGACTTGCTTCAGAGCTTCCAGAAGCAGTACTGTAGTCGTGGTGTATCTATTG
CGAGACAGTATTACCACACCAAGAAACGTTCGGATGAAACACCTCTGGAGTACTTGCATCGTCTCAATGTGGCTGGCCTACGCGCACGGCGCCAGGTCAA
AGGTGGATCACCGGAAGTCCGCCGCGATCATGTGATCACTTCATCGAGACTCTCGATGACCGCGATCTGGCTGACCACCTGGCGCTG