Description :
From Genome Similarity Track
Location :
Scaffold_118:98185- 101828
Sequence
3643 bases(100 bases per row)
CTAAGTCTTCCTCTGATTTAAGGAGCTGTGTAGCTCCGCTACTCTTGGTAGTACTTGTAGTCAATCTATGTCTGAGTCTTTAAAGACTGATCCTCTGTGA
GGATGGAAAACCCACTCCCCTCTCTGAGGCCCAAAAGGTCGCGCTTAATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTGGAATTCCTCGTATCGTAA
GGCCCGGAAGTGCTGACTGCACGTGTTGAGGGCTTCTTGCAGTATGAAGCGTCCCTTCTAGGGCAGGTCCAAGACCAAATGGCGTCGGCTATGCCTACAC
GCTATGCGTCTGTTCCAGACGAAGAGGCTAGGCCTCGTCCACTTAGAGTGGAATTTAAAAACTACTCAGGTAAGGAGGGTGAAAACCTCATCCTCTTGAT
CCGTGAGATTGAGATGGCCATAAGATCAGGCCTGATAAAGCTTGACCATCAACAGGTCTCGCTGGATATCTCAAAGCTCGATGGAAGAGCTAGAGAATGG
TCCTTGACGTGTAGCACGTCGGTCGACTTAGCGTTTCCCACATGGGAGTCGCTTAAGTCACAATTGGTACAGGTGTTTTCACCACCTACCCAGGCTTACT
GCGTGCGTTCACGCTTTTTATCAACCCTTCAAGGTAAGAATGCGTTCACGGACTATTTCCAAAAGCTGAGAACTTTCATGGCTGCTATGCAGGCTGTCTG
ACCTGCATGAGGCAGCCCATGTGACTATATTCACGGAGGGTCTCCGTACTGGCATTGCCAGAACCGAAGTCTTTCGGTATCACCCCTCTACATTAGAAGA
GGCTGTGATAATTGCTCTTAATGCTGAGCATAACTTCAAGTCGGCCAGACTTGGCTGGAATGGGTACAACCCTAGCTCTGCGAGAGTAAACTCCACAAGA
ACTCCGGCCGGTAATAGGCCGGAACCGATGGATCTAAGCTATGCTGAAGATGAAGGTGAAGTTGAACTTCAAGCTGCTGAGCAGCAACGTGTTGTACGAC
GGTGTTACACGTGCGGAAGCACTAAACACTTGCGACCTGGTTGCCCTTTGCGTAGACAGCGCCAGGCTACGAGTCAACACTCTACCCCGAGCCAGAAGTC
TGGCATGGCACGGGGAAATGCCGACACCCAGTAGGCGCGGGGCGCCCTACTGGGGAAGAACTAGGTTCTGTAACACTTTTAGTAGGTAAAGTTGAACAGG
GCTTAGCCCCAAAGAGTTCCATACCTACTGGTATGGAGCGTGGATACAAGGCTGGCTTGTTGGTCGCTGAGGCGAAAGTTAAAAAAACTTTGAAAAGCCT
TGGTCAATTTTAATCGATTCTGGCGCGTCTTGCAATTATGCTCGACGTCGTTCCCTTGAGGGGAGTCAGCTTTATGCTGAAGCGCTTACAGCGCATGAGG
GTGATTCAATCACGGTTCGTTTAGCGACTGGAAGTCGTGTCACTGAACCTAAAGTTCCGTTGTAGGTATAAAGTTTTTGGACTTTGATAGCATTGAACGC
TGTCTTGTCCTTGATTTGGACTCGAGATATGATCTTATCCTAGGTATGTCTTGACTCGAACGCCATGAGCCATGGATTGATTGGAGGTCGAAGACCTTAG
GCGCTACGCGCAATGTTCCTAGCGAAGCTTTGGAGAGTCGTGAACCCACCTTTGCTAGGCAACAAAAGCACTATTGGCACGAGCCAATGATGTCAATATG
CTAGGCATTGGAACGTCTGAGTTAACTAACTCCAATGTTGAAAACATGAATTCCGAGCGTAGTTCGTTGAGTATTAGTGATACGGCACGTACTCCGTTGA
GTGTTACTCGTTATGATAACGAGTCACTGCATGCTGAAAGCATGGTTGGCCTAGGGCCGAGTTATCAAGGATGTGATTCCTTTGATGTGTGTGGGGTGGC
ACGTAAAAATGCACCGATTGCGGTCGGCCGTGAAAGCACCACAATTAATGTCGGTAATGACATTGTTGGCGAAACGCCAGTAAGTTCAGGGCTAGGCCCG
TATAATGTAAGTGGAGTGGCACCTTTAAATCTACTGGGTGAAGTGTTCGAGTTACGTAACACTTCACCGGATGTCGATCAGAACATCAGCTCTCGTATAG
AGCGTACTACTAGTAGTAGTAACCACGGGGACACTATTGTCCCGACCCCAGAGGGGTGTAAGGTCTCATTGAAGAGACGACCTGGACGCCAGGTGGCAAC
TGTTAAGCGCCAGGCGTCTGACTATTGTCACGTAGTGACAATAGTGTTACACTATATACACTTGTCAATGGAGTGACTGGCCAGGTTGAGGGCAATGTTA
GCCTGGAAACCCTTCCATCTTTGGATGCTCCTTGTGAGCTAGACGAAATGTCTGATGGCGAGTGTAGCCAGGCCTTGAAGGCAGGAGATTTATTCGAATT
AGTGGTCATTAGACCCGATGTCGAGTTGAACTCGTCCTCATTAATGGATGAGTCGGTCCTAGAGGACACCAAGGCGACACTCAGTGCCCGGGTGATTGGA
TCTTCTGTCCTTAAAGATCCTTTGGATCCCTTCTATCGTTTGGTAAAGAAATTTCAAGATGTGGTGTGTCAGAACCCACCATCTGTTTTACCTCCCGATA
GAGGTGTACGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTTCGTAACACGGCAGTGGCCTTTACCTAAGGAACAGTGTGACGTCATTGACGATTT
CTTTCGTGCTAAGCACGCGGCGGGAATGGTGTGGGAGAGTAAGTCTCCCCATTCCACACCTACGTTTGTGTCAAAAAGCCTAATGGTAAGTGGCGTATTG
TGCACGCTTACAATAAGCTTAGTGCTGCTACTATCCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTGAGAACAATATGGTGGGATGTACACTGCG
CTCGACTTATTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCCCGAGCTGTATGCTCTGGGAGTGGCTCG
TTATGCCACAAGGGATATCAAATGCCCCGGCTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTATGCATAAACGTACTTTGATGA
CATCTTTGTCCATAGTCGTGCAACGAACGGTCGATCTGATGTGGATAATCACATTGATCATTTACGAGCAGAGCTCGAGTGCATGCGCACGAATAAATTG
TATGCAAATGCATATATGTGCATCTTGGTGCAAAAGAGATTCCCTTTTCTGGAGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGCTAAGGTAA
GAGCCATAGTTGATTGGCCCGTTCCAAAGAATCAAAAAGATCTACGTAAGTGGCTTGAACTTGCCAATTACTTGCATAAGTATTGTGCGAATTACGCAGA
TATGGCTCGGCCATTATCCCATTTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAACAGCGAACATGATGCTTTTCAAGCAGTTTAAGGAAAGCCTTCT
TCATTTGGCTTTGCCCGATCCTGATCGGCCTTTCAGTGTCGTCTCTGACGCATCTGACTTTGCCATAGGCAGTGCTCTGTTACAAACAGATGTCGATGGA
CGCGAACGCGTCATTGCGTTCGAATCTCAACAGCTCAAAGCTG