Description :
From Genome Similarity Track
Location :
Scaffold_962:9815- 11012
Transcript NameFunction/comments
Phyag_g8881hypothetical protein PHYSODRAFT_524421

Sequence
1197 bases(100 bases per row)
agcgccacgacgtTGTCGCCAGGCTTGACCCAGCCGTACTGCTTGCCCAGATCCGTAGCGCGGAACAGAATGGAGTCCGTGCCGATCATCGAACCCATGC
AACGAGACCTGACGCCCTTGTAGAAGCCCTCAGCTTGGCGAGCGCTGCCGGCCATAGCAGTCAACACTAGAACTGGCATCGACGGACGGAACTTGGACAC
TAGACGCGCCGTGCTGCCGGACTCCGTCAGCACCACAatcatcttggccttgacATCGATGGCTGTCTTCACGGCCGACGATGCGATAGCCTCAGCCGTG
GACATGGGGCCGTACGTGTCCAGCACAGCGTTACGCAGCGACTGGTACACATCGTCGTAGTGGATGGCGCCCTCAGCCTGCACACAGatcttcgacatca
tcgacacgGCCTCCGTGGGGTAGTCACCGTTGGCCGTCTCGCCCGAAAGCATCACGGCGTCCGtgccgtccagcacagcGTTGGCCACATCCGTGCACTC
AGCGCGGGTCGGACGCGGCGCCTTGATCATCGACTCCAGCATCTGCGTGGCCGTCACCACAGGCTTACCGGCAATGTTGGCCTTACggatcatcatcttc
tgTGCAAGGAACACCTTCTCGGGAGGGATCTCCATGCCCAGGTCGCCACGAGCAACCATGATGCcgtccgtcttggccaggatCTCGTCGAAGTTCTCGA
GACCCTCGTGCGACTCAATCTTGGCAATAATCTTGATACCCCGACCGCGGGGGCCCAGCACCTTGCGGATGTTGTCAATGTCCTGACCCGTGCGCACGAA
CGACGCAGCAATGTAGTCGACGCCGTGCATGAGGCCGAAGTTGATAAGATCATCCTCAtccttctccgtcaacgTGGGCAGCATCACCTTGCAGCCAGGC
AGGTTCATGTTCTTGCGTTCTCCCAGCGTGGCCGTGTTGTTGGCCCGAGTGACGATCCCGTCGTCCTTGATCTCCAGAACTGTGAGCACCAGCGATCCAT
CGGCCACCAACACGGTTCCTCCCACAGCCACAGACTGGGGGAGCTCCGGGTACGAGCACGCGATCTTGGTCTCGTCTCCGAGGAACTCGTAGTCCGTCGT
GAGTTCCAGGATCGAGTCCTTCTCGATCGTCAccttgtccttgttggcCAGGAAGCCCGTGCGGATCTCGGGGCCCTTGGTGTCCAGCATGACGGCG