Description :
From Genome Similarity Track
Location :
Scaffold_669:9811- 15426
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_669-fgenesh-gene-0.4Heat shock protein 40/ DnaJ domain containing protein
Pytiw_DAOMBR242034maker-piw_contig_669-fgenesh-gene-0.2Protein phosphatase 2C

Sequence
5615 bases(100 bases per row)
CCTAGTACACGCTCCCGACAGGCCCCATGGCCTGCGCAAAGCGCGACGGGAGCTCCACGGCCTGGTCGTCGGCGAAAGTGGCTTCAAAAACGCTGCCGTC
GTAGGCGTAGCGCACGTATCTACAGCGTTAAACAACATACCAACCGTTTAGTCATTAGTAGCCGGCAGACACTCCACTGAGTTCAGGGCTGCACGTACAA
CTTTGGCTTGTCGGCGACCGACAAAGTCGCTCGCTCGAGCGCAGCGGCGTCCTCGACCGACAGGTCGTCACCTATGCACGGGTTGTAGAAGCCCAGCAGA
CCCGCCTTGGAGTGCCCATGCAGCGAAAGCGTCGAGTCCTAACAACGCAACAACACACACGAGTCAGTCGCGAATGAGTCACCCAGAGAGCGCGCCTAGT
GCTAGCTAGAATCACGTACGTTGACAAAGAACTGCAGCGGGATGGTCACGTCGATCCACTTTTGCTCCAGGATCGCGGACTCAGCGGCCACGTCGGCTCT
TCTACTGTCGCCAGTGGCTTCTCTCTCGTCGTCACTGCCATTGTCGCTGTCGATGCCGCCGTCCTCAGCCGCGTAGAAAGCCTGCGAGGCCTCGCTCTGG
CGGTCCAGCGGGTCCGGACTCGTCGGGTTCTTGCCGTAGCGCGCCACGAGGATCACGAGTCCCTTCTTGTCCGCCTTGAGCCGCTCCTTCTCGAGCTTCT
CCTGCGCGCAGCGGACCATGAGCTGCTGCTGCGCGATCGCGCTCTGGCGCGCACTCGTGAGGTACTGAACGCGCACCTCGCGGCGCTGCTCGAGCTCGCG
GCGACGGCGCTTCTCCTGCGCAGGCTTGAGCAGCTGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAACGGCGACGTGGCCGCGCAGAACGTCGAGAACGCGGTATGTGCCGAGAAGGGCGAGAGGAAG
ATCGGCATCACGAAGCGCACGCTGCCGCGCGTGAAGCCCACGCGCAGCGTCACGCCAGTCTTCGCCAGCAGCACGCCCAACGCGACGCGTGTGCGGCGCG
AGATCTCGCGGCTCGCACCGGCAACGAGCGAGAAGCCGCCAAAGAGGTTCGCGCGCACCGAGAGCTTGGCGGACGTGGCGGCCATGAGGGCCCGGCGGAA
CTGCAGCGAGAGGTTCGGCCCGCTCTTGTTGACGGCCACAGCGGCCGTGGCCTGGTAGTTGCCCGTGTCGTTGCTCAGCGACGCCGAGAGTCCATCGCGC
GTGCTCCACATCATCGCGCCGTGGAGCTGCGACGTGAGCAGCTGGTTGGCGCCGAACGAGACGTCTAGACCGTTGTCGTCGAGCTCGGGGATGAGCATGA
ACACGGTGTGCGGGGATACGGGCTGGCTGATCTGGCAGTGCAGCTTGGGCGTCCAGCCGAGCTCGCTCGAGACTGTGAACGACGGCGTGCTCGGGTCGAA
CGACGTGTACGCGAGCTGCGTCGTGAAGCTGCCCATGCCCAGGCCGTGCTTGTCGTACATATAGCCGCCGACCGTCAGGTTCAGGTTGCGCGTGAGCGGG
AACATGGTGCGCTGGTGGATCGTCATCTCCGTGCGCTCGACGTACCGCCCGCCGCGGTGGAAGAGGCTGCGCAGGCCGCGCATGGGCTCGCGCACAAAGT
CCGACGCGTCCACGTGCATGGACATCTCGCTGAAGGACGAGAACTGCCCCTCGAGCGCCTGCGTGTTCATGCGGCGGATCACGTCTTCCACGTGGCGCTG
CATCTGTACAGCATCCCAATGGAGGCACACTCACGTTAGCCTATCCTTCATGCACACACAAGCACACATAGAGAGAGCAACAGCACACCTCTTCCGACGA
CTTCAAGTGCGTGCCGACGACGTTATGCAACGCCGCGTCCTGCTCCAGCGCTTGCACACCCTGTACAACCGACATGACACACAACACACACCATGAGCTC
ATCAATGCACAGCTCAGCAACACACGCACACACGACGCACCCGCTCGCCGTAGAGGTTGTAGACGCGGCGCTTAACCGGGTCGCAGAGCACCTTGTAGGC
GCGGTCGAGCACCGGGTACTGCGCGTTGGCGAGCGCGACGAGCGCCTCGTCCTGCTGCTTGCGGCGCCGGTCCGGGTGGAACTCGCGCGAGAGCGCCAGG
TAGCGCGCGCGGATCTCCTCGCTGCTGGCGTCGCGCGCCACACTCAGCAGTGCGTAGTAGTCACGCTCGAACTGGCGCCAGAGCGCGTCGTCGCCGGCGT
CCGCGCCGCCGCCGCGCGTCTCGTCGTCCGCCATCGCCACCTTCAGATGAGCTCGTGGCTTTGTATGTGTGCCACGGGAATAGTACCCCTCTACCGACAC
ACACTCTCTGTGTGGGAGGTCAATTTGTACCCCCTACCACATTTTGCCTTACTTATTACGAGCAGCTCAAGTGAAGAGCTATAGTACCTGTGTGTGTGAA
GGCGTGAAGGATGCCGAGCGTGCGCGACGACGTGGAGGTGTCGCTGCACGAGCACCGCTTCCTCGTCACCAAGCTGCTTGAGTCGCTCAGCACGGCCTCG
CTGTGCGTCTTGTCTCTGAAGGCGAACAAGCACGCGTCTCTCTTGTGGGTTGTGGCTCATGTGATTGTATTGTGTATTGTGTGTGTGCTGTAGGCCGCCG
TCGACGATCACTGCGACGCGCCTGCGCACCGTGAACGAGACGTTCGGTAAAGCGCTCGAGAAGGACCGCGAACTGCTCGCTGCGGTCAAGAAACGTACGT
TATTTCCATTGCTTGTGTGAGTCTCTCTCTATGGCATTGCTGTGTGAAATAAGGCGACACTAACTGTGTGCTTGTGCTGTGGCAGTGGCGCGCCACCAAG
TCGCGCAAAAGGACCTCGCGGCCATCCAGGACGAGATCCAGAAGAAGAAGCAGCGCGTGATCCGCTATGCAGCCCAGCTGCGTCGCTCCCAGGAGGTATG
TGCCTGTGGCTTGTGAACCTCCACGGGTAATACGTATGTGTGGGTACGAGTAATTTCTTACAACCTGGCTGCTGCTACAGGACATTGCGAACGTGCTCAA
GAAACACCAGACGGTACTCCAGCATGCCAAACAGAAGACCAAAGGTGGGGCGTGTTGTATGACCCCATGGCTCCTGTCGTGGCGCCCTTGTATTGACTTT
GGCGTGTGTTTCTTGTTTCTTGCAGTGGTGTTGGACCCGCGAGACATTGTCGCGTACGCGCATCGCATCGCGGGCACGACGTCTGCGCCACGAGAGTGGC
GTCCAGGGGTACGCTGAAGAGCCTTGTGTACTATGGTGTTACGGATGTTTACCTGTTAACCTAGTTATGTGTGTGGCTGTGTGTGTGCTTCAGTTCCCCA
TGTTTGGTTTCATGCCGCCCGCGCCGCAAGGCCACATGATGCGCGCCGGCGTGCTCAGTCGTGGCATCGTGGACGAGATCGTGACCCAAGAGGCCGAGAA
ATACTCGTCGACCGCGAGCAAAGTCAAGAAGGACGACGCCGACGACGAGCTCGAGAAGCTCAACATCCCCATCGGGCTCGGCGCGAGCGACGCGCAAATC
CGGAAGCAGATGCCTGCGGGCTGGAAGCCGGGGGACCCGGTCGACCTGCCGCTCGATGCGCTATTGCACTACATGGGGCGCAGTTTCTTCACGGTACGTG
GGAGCTACAGTATCACCGTTAAAGCTCGCTCGCTAATGGTTTGGGAAACATCTACACGAAACGTATCTTAGGAGCAAGGCATTACGCTCCCCGAGTCCTG
GAAAGCCGGCGATCCGCTGCCGCCAGACGCGATGGAGATCCTGCGCAAGAAGTTCAAATTCCCCGAGAAGCGAGCCGCGCTCTACGACGACGAAGTCGTG
GACGACGTCGAGAGTCTGCGCAAGAAGCGCAAGCTTGGGGACTCGTCGGACGCCGACGAGAGCGGCACCGCCACGGGCAACGAGACTGGGTCTGGGAAAG
AGGACGACGACAGTGACAGCGACAGCGACAGCAGCGACAGTGATTCGGACAAGGAGACGGTGCAGAAGATCTCGCTCAGTCTTTCCTCGGACGACGACAG
TGACGACAGTGACTAGAGTGGCGTGTTGTGGAGCTGAGAATGAACGCACGAGCAGGCGGCGACAACGTATAAGAGCGAAACAAGAACCAGTGTTCGTCGG
ATCCTTTCATCTCTGCCTCCAACTTGGTACGTAGGGTGAGCTGGTTTGTGCGTCTATTAGTGTAATTTGTGGCAGGGTTACACAGTTCCGAAGCTCACAT
TCACTTGGAGGCAATGGATGAACGCGAGACATTGTAAGTGGCGAGTTGGTGATGTGCGAAGGTCCTAATATTCACCCACGTCTTCCTTCTCAAGCCAACT
GAAGCTGCCTATCGATTCCTGAACTCACTATCGTCTTTTCGTCTTCTCTTGTACAACAGCCTGTAGACATCGAGGTGAAGATTCGAGCGTATCATGATCA
GAGAGAGCGCAGACAAGAACATTGTCGATCGCGAAATCGGTGGAGGAGAAATCAGAAGACGGGGAAGATCCTTGTGCCGAACCAACCGAAGGCAGAGTGA
AATCGCGAAGCTGAGTCGCATTGTTGATGGCCTGGATCAGAATCCAGCATGACCGACTGAGAGGTGAGGGTGTGTTTTGTATTTATAGGTGGAGATCAAT
GCGTTTTCCATCCGTTGCAGCCTTTTCTTGACAAGTCACGGCGCAAGACCGAAGATCGCAACGCCACCCGATAAATAGATCAAGCCAAGAGCCGTCACTG
CATGATTGATGGACTGGTACGTGAAAGATGGCGGCGCAAAACGATCGATAAGCTCGACAGAATCCATGTTTAACCTTGCTCCTGACATTGCTCCTGTTGT
GGATTTGGGAACCAGCGAGCGCGTGAAGGCAAAAATAGAGACCTGGGACTGCGACGACGCACTCTCCACATATTTATTGAGTGAAGCCCCCGCCCGCGCT
CCGTTTCTTTCATTCCTGCTTTTGCACCGCCACCGTCGAGCGTCGTGTCCCAGTCTTCTCCTCTTTCTCCCAGCGCCGCCTCGCCCAGCTTCACTAACTT
CCTAACGATGGCTTTGCGTCAAGGGGTTGCGAAAAATGGCTCGGTCGCCAAGATCCGCCAGCAGGAAGCCGCGACGGCCGTGAATGTGGCGTCGCCCAAA
GGCATCTCGAAGAAGACTCCAGGTATCTCACCCTCCAAGGCTGGCGTCAGCGACCACACGCTCGGGCTGCAAAGACGCCGCCTCTCAGTCGTGAGCGACA
ACAAGCTCGTCGAGGGCATGGCCCAGGTCACCACGACGGACGTCGACTATGTCGAGGACGGCTCGAGCGCCGTCGCGGCCTATGCGGGGCTCTCGAAGAA
GGGCTACGCGCCGTACAACCCGCGCAAGAAGAACCAGGACTCGATGATCATCAAGCACGATCCAGACACGCGCTCACTGCTGCTCTGCGTGTTTGACGGC
CACGGCGAGGCGGGC