Description :
From Genome Similarity Track
Location :
Scaffold_470:9810- 11316
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_470-snap-gene-0.10Hypothetical membrane associated protein

Sequence
1506 bases(100 bases per row)
GATGACACTCACCCCCACCTCTTCACCATCATTCTCCTCTCCGTCGCTGCTGCTGCCGCCACCTGCGCCATCCATGCCAGAGAACAGCAGCAGCACCAGC
AGCAGTGCCGCTACTAGCATGAAGCAAGACGAAGTGCGCCTGTCGCCAGTGCCGTCGGCGCCAGCTTCAACCGCGACGGAGCGGTGCCAGCTGGAGGACT
ACACGCCGTTCTCCAAGTGCCACCTGTGGAAGCTCATGATGTCGTTCTACGACCGCGAGGGCGTCGAGTCGTGGGCACAGGGCATCGTGCCGCACTTCAT
TACGTCCAATACTTTCATCGCCAAGCGCTACAGCAACGTGCTGCGCGCCTACTTCCGCGATGTCATGCGCGCAGGGAGCGAGCATCCGGTGCGTCTTCGT
TATATTGTCACTTCTATATTGGACTGCTCATCTAACATTTACCATTTTTCTGGATGTGTGTGTGCATTAGCTGGATACGTCCGAGCCGTTCTACATCGTG
GAGCTCGGCACGGGCTCGGGAAAGTTCAGCTTTTACTTTCTCAAGGCATTAGCCGAAGCCGAGGTACAGTATGATCTGTGCACCCTCACTTTCATTGGCG
GGTTCATACTCCATGCTAATGAGTTGTGTCTCACTGTATTGTGTAGAGCGTGCTGGACTTCCCGCTGGACAAGATCCGCTACGTGATGACGGACTTTACG
GAACAGAACTTTAACTTCTGGAAGACCCACCCGGCGCTCGCACCATTCGTGAAGCGTGGCATCGTGGACTTTGCGATCTTCGATGCGACAAAGGACACGG
AGCTGCGTCTGTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAATCCGCCCCCAGGAGCTCAAGAACCCGCTCTGCATCATCGCCAACTATT
TATTCGACACGCTCTACCACGACCTCTTCCAAGTCGAGCAGGGCATGCTCAAGGAAGGGCTGATCAGCGTCGGCTCGCGGAAGAGCGTCGAACCGGACCC
GCTCGACCCGGAGATCATCAAGCGGCTCTCGAACCTGTACAAGTACGAGCAGATCGACGAGAGCTTCTACGGCGAGGACAAGCCGCATCTGAACAACATC
CTTAAGTGGTACCACGAGTACTACGACCCGGCGTCTTCCGGCGCGACGATCCTCGTGCCCATCGGTGCGCTCTCAGCGATCGAGCGGCTGAGCGCGCTGT
CGTCGAACCGCCTGGTCGTGCTCTCGGGCGACAAAGGCAACAGCAACCCGGACCATTTCCGCGGTGTGAGCGACCCGCACATCGCTGTCCACGGGAGCTT
CTCGGTCATGGTCAACTACCACGCGATAGGCATCTACTTTGCGAGTCGCGGCGGCTTTGCGCTGCACAGTCCGCAAGAAGAGGCGAGTCTGAAAGTGTCG
GTGTTTGTGCTACCAGGAGACAGCACGTCCAGTGGTGATGGAAACCCAGGTGCGACAAGTATGGAGAAGCTCTATGGCGAGGATCTGGACCACGTCTGCG
AAGAGC