Description :
From Genome Similarity Track
Location :
Scaffold_1267:9808- 11609
Transcript NameFunction/comments
Phyta_totarag12570hypothetical protein
Phyta_totarag12571copiatype polyprotein putative
Phyta_totarag12572hypothetical protein PHYSODRAFT_310667

Sequence
1801 bases(100 bases per row)
GGCGTTAAATGGTGTGGCTTAGCCGACAGATCGTCATTTTATGAGCGGTTGATTAAGACGGACCCAACAACACGACCAAGCGCAGAGGAAGCTTTACGCG
ATCTGGTGGaacttgaagaagaagcaaagcaggaacaggaagcTGCGCACGAGTTGCAGCAGGGTGAAAATACGCGTCAGAGTCGAACGCAGTCTCGTAA
GCGAAAACTGTTGTGATTCACACCCGATCCGTATGACCAAAAGCCCTGTGCACCAGTGGGGAAAATGAAGACTGAATAAATTAACTGTGTCAGTATCTCA
ACCTGAGCTCCTGCCAACACTCACGGGTTCATCCCGTGTCCCACCTAAAGACCTGGCCCCTTAaacttcttccagcttctccacgctcaCGGTATCAGCA
CCGTTGAGCCAGGTCTCAGATATGCAATCCAACACGCCTCCCTCGAAGCCCAAgcctcgacttcttcacgtcgTATATGCcagtcagcaccagcaagttc
TTCAGACGCTTTTTGTCGAGTGGCTTCGTGAACGTGTCAGCCGGGTTCACTTCGCCTTTGACCTTGTGCATTTCAACGACACCTTTCTCCACTTGTTCAC
GAACATAATACCATCGTAGCTCAATATGGCGAGTGCGACGGCTGTACGTGGGATTCGTAGCCATCACATGTGCTGCCTGGTTGTCGATTCCAATGCGTAA
CTTCACATTGCATTGTGGGAGTATTTCCTGCAGAATATTACTCTCAGCAAATGCTTCCATCGTAGCCTCACACGATGCCACATACTCGGCCTCTGCCGTA
GATAAAGCAACGATTGACTGTCGTCTCGACACCATGAGattgctccaccagcaagtAAGAACACAAAGCCTGTAGTGCTCTTTTGTGTCTCTGGATCGTT
CGCCCAGTCGCTATCGCAATAACCATCCAGCACCTCATCCTGTGCCACACACTTCTGTCTTTCGTAGGTAATGCCGTAGTCCACCGTTCCTGCTAGGTAG
CAAAGCATCCGCTTCACAGTTCCAATAGGCTTGGTAAACGGCTTAGCCACGAAACGACCCAACTGTTCTAATGAGAATGCCAGGTCTGGCCGTGTGCTCG
CGTTCACTTCCATCGGATTGCCCACTGTATGTGCATTTTCATAGCTGAATATCTCGAGAATTTCATGTGCATACTTGGACTGACGAATCGTAATCCGTCC
CGTGGTCTGCTCTACTTTAAATCCTAAGTACTGAGTCAGCAGTCCCTGATCCTTGATGCCGTATGCCGCATCCAGATCTGCAAACAACTTCACTTTGAAC
TGCTCATCCTTGGTCGCAACTAAAATGTCATCCACGTAGATCAATACATACGCGATTGTATCACCCTCGACATGATAGCATAGACAAGGTAGCCCgaagc
ctgcagcaggtcgtgcCTCTCTGCGACCGAGTTCGGAGCACCGactggatggagctggaccAAGCCCTGCGCGGCTCGAAAGGGCTGTACGGGCGCACCG
TAGACTTCTTCCCTGCGCTGTTCCGCTCCTCAGACAGGCGGGTAAACCCGAACAAGGCTCGCGACTGGTGGAGGAAGCGCGCAGAGACAGCAACCAGCCT
CGAAGACCCAAGGCAACTCAAGTATGCAACAAGCCGGCAGCGAACTCGACACCAGTTCGTTGTGAAGACGCTCGGGGGGAGAGGAACGAGGCTCGGTGAG
CATTGGGAATGGTTATACCCTCTCTTGCTGACAGAGTTCCAGCGGCTTAGACGTGCAGGTGTCAAGCTCTCCAACCAACTAGTAGCTGAAATgggcgtcg
t