Description :
From Genome Similarity Track
Location :
scaffold_20:98057- 99782
Sequence
1725 bases(100 bases per row)
GCTTCCCCTGCAAGGTTCGCAGACGCATCAGTTTTATCGCGCTGGATGGCGAGCTAATCCAACGCAAAATCACTTTCTGTGCGAAGTGTGTGAGTGCAGC
TACAAAGTGCGATGCTCAAAATGCTGCAAGAGATCAAGCATCGGGCTACGACGCATATAAGGCTCTTTCGACCTCTTCGCAATCCAACACCGTGGAATCG
TCGATGTTTGAATAAGTCTCATCAAGACTCTCCTTGATAGGAAAAGAAATCGAAAAATCTAATGTAAATGTAAACGTAGTTATGCTTTCAGCGCCAAGTC
TAACGACGCCATCAAATGATTTCGGAAAACAAGTTACTGGAGTACATCAAAGCGTCCTGTCTGAACGACACTGACAGATTGACAGATGAACTCCTTGTGA
CACCAACACGTGTCCTATCCCCACTGCTGAGCGTGTCGATGTAGTAGTCACCCCCCCTCTGTCGGATGTCCCTTCCCAATATTTGTGAAATAAACGACAA
GTAGAGGAACAAGGAGATGGAGTTGATGACATGAGGTGGTGCCAGCCTGGATTGGAAGACAAGCACCACGGAGAGGTCAACAACGGCATCTTGGAGACTG
GTTGTGTGTAATTGGTGTAATTGTTGAAGTCTTGAAAACGTTGCTTATTCTGTTGTATACGAAATGAAGAGTACGTTGTCTGATTCACATCCAAACTTTG
GATCACACATTGACGAATTTGGATAAAACCGCAATGGAATGTCGATATGTGTAGATTGTCTCCACGACCTAGAGGGTAAAACGATGTACTCAATCGATTA
CGAGATATCACATTTCTCCGTAGTTCAAAGGAATTCTGGTGTCTGTCAGTTCTTCTCCGAGTTCAATTTTTCGGTTGCGTTGTTGTTTGTTGTTGATACA
ATTTGGATTGTCCGTCTGTAAGGTACGCTCTCCAGCTTGTACAGGAGTCTAAGTGTACTATACGCGTTTTTGCAGCTGTGTCCGCGTCATTCCTTTCGTA
TGTTCCTAGGCTGACCACATTCCGCCCGATCAATCTTGGCAATGCCTTGACGTCCGCACGCCACCTCTTCCTGATTTCATCACTTCCCATTTTCATGGAA
TAGCGCATACTTGAGACCAACACAACACGCCAACGTCGGACCTTACCATCGGTAAACTGTGCTGCACGAAAACAAACATCCAGATTGTAATGCCTTCAGG
GGTGACCACAAAGCAGATTATTTACTGCTGTCGACATGTCCGCCCACACACCGCATATTTAGCGTCTATCCCTGTTCAGTCTCTACCTCTGACCCTGTCC
GACATTCTACACTGCGTGCCTGCAGGTCCGGTCGTCCTATTGTTCAAATCAAAGGATCAAAGATGGGGGTGGGTAGGCTGCCTGACCGGTCTGCGGCATA
TGGACCGCACGGACTTGAGCTAGTCTCACTTAGCAATTTCTGTCGGTGAGCGAGGAACGATCCCCACATAAGCGATGCCTAAGGACGGATTCTCCCGAAA
TCCCTATCAGGACATTCACGTGTCTGATCACCAACGAGAACAGCTTATCGAGCTCGTCAATGGATGCGTGCAGAACCATTTTCAGAAATACGAACAGTAT
TTCGTCGCAGATCAACATCGTGTGGACGATCGACGTTGGGAACATGTCAAGTCCAAAGACGACCTTCACGTGTATAGTGAACGATCTCAAAAGGATCAGG
CGAAAAGAGGTCTACTACCGACGAA