Description :
From Genome Similarity Track
Location :
contig_54:98056- 99460
Transcript NameFunction/comments
g9140.t1hypothetical protein

Sequence
1404 bases(100 bases per row)
GGCCGCCGCGCTCCAGATCAAGCCCAATCGCATCCTCTACACGAGCGTGCTACTCGCGCTGCTGCAGCCCTTCCAGAGCGGATGGTCCACCTCGCAACTC
AACCTGTCCGACTACAAACACGGAAGAGTGCAATGCTCGACCCGTCGTCCCGGGCACATGCACGCTCTTCTCCGGACACTCCAAGCTCGAGTGGCTTTCG
CCGTGAACTCGTGGATCTTCGGCGCCATGGTCGGCAGTCTGCTATGCGGCTACTTCAGTGACATGATGGGCCGCAAGAAGCTGCTCTTTTTCAACTGCTT
CTTCATGATCGGCGGCGCCGTCATCCAGGCGTCCGTCTCCAATGTGTGGCCATTCGCCGTCGGCCGCGCAGTCTCCGGTATCGCCTCAGGTGCCGCCACC
GGCACCATTGGCGCGTACGTGAACGAGCTGTCGCCACCGCACCTACGCAGCCACCTGGGCCTCGGCCTGCAGATCTCCACGACTATCGGCATCTTGGTGC
CGGCCATTTGTTTCTTCTTCGCTGACAGCGGCGATGGATGGCGCTACATGGCCGGTTTCCCCATCGTGCTGGCCGTCATCTTCATGCTGCTGTCGCCGTC
GCTGTCCGTTGAGAGCCCCGCGTGGTTGCTCATGAAGAACCGCCGCGAGGAGGCCAAGCAGGTCATCACGCGTCTATATGGCGAGGAGCACGTGCACACG
GCGCTGGGCTGGCTCGAGGCGTCCAAGCAGCTGGGCGAGGCGGAGGCAGGCTACTCCACCAACACGGAGCCGGCCGAGTCCGTGCTTTCGCCCAAGTACC
GTATGCAGTTCCTGGGCGCACTCCTTCTGTCGTGCACGCAGCAGCTCTCGGGTATCAACGCCGTGTTTTACTACTCGGGCGACATCTTCTCGGACGCCGG
TATCGACGACTCGCGCATCGGCACGCTCATCATCGACTTCATCAACATCTGGCCCGCCTTCTTCACGGGCGTGCTGGCCACGCGCTTCGGCAACCGCAAC
ATGATCCTCTGGGGCATCGCCGGCATGGTCGTCATGTCCATCGGCATGACGGTCGCCTTCCTCGTGGACGTCTCGGAGCTCTCCATCGTCTTCACGGCGC
TGTACGTCATCGTCTTCGGCGTCACGCTCGGTCCGCTCGTCTGGGTCATGACGGCCGACATGTTCCCGGACTCGGTGCGTGCCAGCGCGTCCTCCATTTG
CATCGGCGCCAATTGGCTCTGCAACCTCATCGTCGGCGTCGGCTACCCGTACCTGGCGGACGAGCTGGACGACTGGAGCTACGCGCCCTTCACGGTCTTC
CTCATCATCTTCTACTTCCTCTCGCTCAAGCTCGTGCCGGAGACGGCTGGCAAGACCAACGAGGAGATCCAGGCGGAGTACGAGGAGCGTCGCCGTCGCT
GAGG