Description :
From Genome Similarity Track
Location :
Scaffold_774:9805- 11622
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_774-snap-gene-0.6GJ12538

Sequence
1817 bases(100 bases per row)
GATGGCCGCGTCGTGCGATCGGTGCTGCGCGGCATGCTGCGGTACGGCGACCTTACGGACGTAAACCTCTTCCCGCAGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCTCTTCCCGCAGGAGAACCCCAAGGCGTTCAATGACGAGTTCAAGCTGCCCAATTTTGTCGAGCGCGCCATGCTCGAGACGCACTG
CAAAATGTCTGAAGAAAAGATCCTCGCTCTCGCCTGTGAGATCGCCGAGGCCGTACAGCGCGTCGTGCTCGCCGACAAGGACACCCTTAAGTTTGGCGAC
GTGGAAATGAAGCCGTCGCAAATCATTGAGCGTCTCTACGAGAACCTCAAGCTCCGCGTCGCCGTGCAGCGCGCGCTGTATGACGTTGGCGCGAAAAACA
GCAAGGGCGGCGCGTCGCCGAGTACCGCTTACGTGCTCGTGTCGAAGCATTCGGACGCGTCCGTGTTGGGCGTTGGCCGCGACTTCCCGGCGTGGTCATG
GGCCGAGCGAGAGCACGACTGGAACAGCAAGAAGGACGCGGCGCTGCTCATTGGCATCTACATTCACGGCTTTGGGTCGTGGGAAGACATCTTGAACGAT
GATCGGCTGAATATGCAGCAGCAGCGCGCGCTGAAAGGGGAACGTCTGAAAAAGCGCGCTGAAAACTTGCTGAAACGCGTGCCGCCACCGCTATCGGGTC
CCGCCGGTGAGCCGCGCGTCGTGCAGATGGCTGCGGCCATGCTGAGTGGCGCGCAGACACCGGGTCAGCAGCTCGGTGCCAATATCAGCGCGATCGTGAA
CGGCGCGATGGTCAAGGGGGGACGTATGCAGCGTGCGGAAGAGCGGCTCGCGGCCCGTGCTCAAGGATGCGTCGATAGCGGCGTCGACGAGATCCCCGAG
GATTCCATCCGCAAGATCCACACACAGAGCAACGGACGAGAGCGCGAACGATCTCGGGATCGATCGGCCGAGAACGTTCGTGAGAAGCCTCGTCCTGGAG
AGCGAGAGCGTGGACGAGACAACTCACGAGAGCGCTCTCGTGATCGAGACCGCGACCGTGATCGCGAACGAGACCGAGACCGTGACCGTGACCGTGGCCG
TGAGAAGGACCGAGAGCGTGAACGGGAACGGGAACGCGACCGGGGCCGGGACCGCGAGCGTGACCAGCAGCGGAAGCCGTCAGCGTCGCCACCGCCCACG
CGGGCACCGTCGCAGTCGCCGCGAGCGGATTCTACCAATGAGACTCGAGACTCGGCTCGGCGTGAGCACTCGTCGTCCAAGAGTAGTTCTGCCGGTTCCG
TGAAACGTGCGGCGTTTGACGAGGCTACTAGCAACGGCGACAAGGGACGTGGCGACGGTGGCCATTCGCCACGGAAAAAGTCCAAGCTCCGCGATGGCGA
CGCGGCTCCGTCTCGTGCTTCCAGCGGATCGAAATCCAGTTCGGAACTAAAGACCTCGTCTTCCTCGTCCTCCTCGTCGGCCAAGCGAAAGCGCAGCGAC
ACGAGCTTTGTGGACAAGTGGAAGCCCAAGCAGCGGCTTCACGAGATCCGCACGGTGCTCAAGAAGGTCAAGATCATGAGCGACTGGTCCAAGACGCAGA
GCGACGTGGTCGTGGTCGACAAGATGCTCGAGTACGTCGCGACCATTGGCGAGCACATTGACAAGGCCGTGGTCGAGGCGTGCGAGCAAACCGGCGAGGT
CAAGGAGACACAGCGCGACCAGTTTTGCTCGGCGTTGTGGACCTACGCGGCCGAGTTTACGCCGTTCCCGCCGGTCACGTTTGAGCGGCTCTATGATGAT
TTGTGTGCTGATGGCGA