Description :
From Genome Similarity Track
Location :
scaffold_28:98047- 101784
Transcript NameFunction/comments
Pl_111819conserved hypothetical protein

Sequence
3737 bases(100 bases per row)
CAGATACAGCAATATTAGTCGCTACTGGTCTCGTCATCATAAAGCGCATATCTTCCGTGTACAAATGCTCTTGCTGTGGTGTATTTCAATATCACTTCAT
ACTCCAACAATGCGTACCACTCCACGTAATAAGCTGCAAAATTCACAACATTTTGTAATCGTAGTGCACCAACTTGCTAGCAACTCGACAGGAAGGTTTG
TTAGAATTGATTACCGTTTTCGTGTCCATACCCCTGTGTCATTGCAGCTGAGACGTGTCCTCTAGGTATGTCCTAAGCAAGCAAACCTCCCACGCGAGGT
GAAAAAGGCATTATTTCGCGAGAAGACTGCGCCAGTATCAGCGCTTTGATGAAAGTGGCCAAATATTCAGCCCACGGAGGTGTGCAAGCAAAACTGAGCA
CTAACAACGTCACGTTCATGCGTCGTATCAGCGCAATAGCGTGCGCGTTGGAACTGCAGATGAAGGAGTAGACAATCCTATCGCTTATACAATTCGTACA
CTTTATATCCTCCCAGTACACGATAGTATAAAGTACACGATCTTCTGAGTACAAGCAATTGCTCTCTGCGTACAACAAAAAGTGACGTGGGTACAGAAAT
ATGAGTACTTACAGCAAAAATAACGCTGGGAACTTCAATGATGTATTCTTTAGTTCTTCCAGATGTACCAGATGCCAATGAAAACGAAAGGGAGAGAATC
CATTGCCGATGTTTGTGGACTTTGTGTACAGTTGTTCGTGTACCAGGTGCTAACTTGGATGGATAATTATCAAGCGAAATCGCAGTGGGATCGGAGGAAA
CCGTATCGAGCAACTTGTGTTGTGTTGATCCATTTCAACACCTATAATTTATTTAATTCTATCATAATTATTTACTTTCATCGTACTCACTACACCAAAC
ACTAATTGAGGTAATACCTCTTCTAAACTCAGCTCACATTGAGTTTCACTGAGAGCTGCAATTTGCCGCCCTTTGTCGACCGAGGGACCCACAGCAGCAA
CGAACCACCACCTGTGCCAGGAAGACCCAGAAAACCAGGGCGCCAGCGGTCCAGGCACAACGTCTTGCCTCCCAGGGTGGTCACATTCGATCTCCAGGTG
ACAGTCGCACCCGCCGCGACTGTAACTTGGTCGATTTTATCGCCGCCAGACTTAATGTTCACAGTCACATCTTCAGTGTCGACACTCTTGAACGTAACAG
TGACAGAACCGTCGCCAACCTTGGTCCAATTTCCTTCGCTGTTGTTGAAAGCTGCCTTCACGGTCTTGAAGCCCAAAGCTTCTTTAACAGTACCATCGTC
AATATCACCGACGAACTGTGTGGGTCCGCAAATGGTCTGAAAGAACTCGGACATTACACCACCAATATTCTTTCTGTCCCAAACAGCGTAAAATGTCGCT
GCCTTGTCAGCGATTTTGTATGCATACTGTCCAGCCGTCAGCAGTGTGCCATTGCCGCTCGTTCCTGAACTGATTAAATCGTCAATAATGCTTCCAAGGC
CCTTGCGCAGAGCTTCCCGCGTGGTATAAGCCGTTGCCTCATCGGACTCGGCAATCAATTCTTCCATGCAGTTATTTGTCACAGTAGGAATTTCGTACAG
AGCGAGGTTCGACTTGCTCATCGCAACACGGATATCGTCTTCCGAAATGCTGGGGTTTTGTCGACGCAGCTCTGCTACAGTCATCCAGGTGCGGTCCAGC
ACTCGCTTCATATCGTAGCCGCACGTCGAGTTGGATTCCAGCGCTGACTGTAATGATGTAATCTCGGTCTTGTTCAGCGAGTTGATAGTCTCACCTAGGG
TGATGTTCTTCATAAAACTTGTGAATGCGCTCCAACTGGAAACAATAGCGGCACCGTTGGCTATGATTTCTTTCAGAGCAAGCTCGCCGGTGTTCACTAT
TCTGTCCATGAACTTGAATTGCTCGTCCACCTTGATTCCAAGACACGACATAATAGTCACTGGAATGTCGAACACGACGTTGTCTGTCTGGTACAACATT
GTTAGCAACTTCTCATCGGAATTCGGGTCAGACACCTCGACCGTGCGAACGTACTTGCTCAATGCCTTAACCAATCCCATCATCTCTTTGGCACACTTGA
CTGCGATCTGGACACCCTTCGCCATTAACTTGAACTGACCGTACAAATTGTACGTAGCTACGGAGAACGCTGCCTGGGCTACGGAAGAAACCTTGCTGAC
AACCGCAAGCGTACAGTCGTCGTTTTGACGAATGCACTCCATTCCACACTCGACGGGGTACGAAAGCGGGCATTGCGCCCAGCACGTTCCAAGCTTGCCA
TCATATCCGAGCGGGCACGTCTTGGCAATGTGAGCTTTGCGCCAGCATGCCGTGTCGGGAGCAATACCGAGAGCGGAGCCAATCCAGTTCTTGTAGGCGG
ACTTGATTGTACTGGTGGCATTGAGTGGGTTGCCCATAGTAAAGCCCGAAAGAGAGGAGTCACTGTCGTCATTGCTGTCAGATGAATCGTCATCGCTGTC
AGAGGAATCGTTGTCGCTAGATCCTTCGTCTTGGCTTTCCTCGGACTCATCGTCGCTGTCTTCATCGACGAAGGTCACTGTTGTGTTAGAGATGGTTGCA
GTGCCATTTACTGTGAAGTTAGCAGCAGCCACTGTTGCAGTTGGTATTGACGCTGCACTGTTATTAAACGTGATTGATTGTGCTGAAATAGTTGTGCAGA
AGACCATCGCATATACGAAGGTCAGTACCAGTAGCAACCTGGTCATTCTTGTCGGTGCCCAGCGCGCCGCAAAATTAAGAATGAGTTGCCGTTCACCAAA
CCGCCAAAACACCGAGCCAAACGCCTCTTTTACGAGCGTCCTTGGCTGGTCGTCTTGCAATGCATCGCATGTGACCGTCTCAATATCGACAGATTCGTGT
TGGTTGTGAACACCGTCGTCCAGACAAACAGAAACTTCAGGCTTGTATTGAATCTATCGTTCCGGCGTGACGACGAATCTTGGCAGGCAAACAGATCAGC
AACGGTGAACGGTGACAGGCGCTCCTCCAGTTGTTGGCGCCCCGAGCCTGTGAAGTGACGGAGACCATATTTCGGAGTACCTTACACATGCCCAGATGGT
CACAATTAAACTCGGAGAATTGTGAGTGGGGTTGTCCCCGTGATTCAGTTGGCTAGCGCTAATGCTTGCCAAGAATCTATAGCCACCACATCCCATGACG
TGGAAGAGATATCAACAGGATTGGCCTACCATAGATGAGGCTGTTGTAATGGATCGGAGCGTCAGGACGTACATAATCTTAAGTACGTAATGCTAAAACG
ATTTGCAAACTGCAGATTCCAAGTCGAAGTTGCAGTGGATCAGCTGCAAGCGTCTGTGCAGCTTCCTACCTTGTATTGTTGCAATTTCGAATGCCTGGAT
GAAGCGGGAATAGCCTTGACCGACCGTCTCAAACTCATCAATCGTCCTTTACAATTATGCGCTTAGATTGGACAAACAGCGAATCTAAATAGCAGCCGTC
CTTCACTAGCACCTAGACTGCTGGGCTTACAGCAATTTCTGGACCGCCCCTTGTCTCCTGCAATGTCCAGGCTGCCTGACGTGATCCCAACGAAGGTCCA
TGCCTTCTTCTCGAAACTCTATAGCCAACGCTGTAAAATTCCCACTCAACCTGACGGTGGCGCTGTTGCCTACACGTAGCAGTGGAGTTAGCAAGTACGT
AGCACTAACAATCGTTAATTGCCCAACGGCCCCCTTC