Description :
From Genome Similarity Track
Location :
Scaffold_1177:9800- 11082
Transcript NameFunction/comments
Phypl_g12660hypothetical protein
Phypl_g12661polysaccharide lyase, putative

Sequence
1282 bases(100 bases per row)
gacgTTTCTGAGCGTGCAGGGCATTCAGTTCTTTACGCAACCGTCGAGCCTCTCGCCGCCCTCGATGCCCGCGATAAACTCGCAGGATTTCCGCCACCGC
TCGACGCTGAGCTTGCCGTCCCAGCTCTAGCGTGACCCCCCACCAGTGGCGAATGTAGAGTTTGTAGAACCGGTGCTGGAAACGGATCAACACGTTGCGT
GCAGCCTCCAGCGCTCGGTCACTCGCAAGGTTCCGTTCAAAGAGGAACTGGGATGGCAGAATCTTCTCGGCGCGAACGAGTTCCTCgcgcagctctgcgt
caGCACGTTCCGCAGCCTTCTCGGAGCGCCGCAACTCGTTCTCACCAGCAACCAGCGCACTTTGCATCAATTCGATCGTCTCCGTTGTGTTTGCAGCCAA
CTCCTGTGCAATGGTCTTGCTATTGTTGTTGATATGACCCCGCTCAGGTGATGAGGGGACAGATTCCAGTCGAGCATCGACTGCGGTACGGTGGGTACTT
GTAGATTTCTTTGGTGATACTTTATCTGGTTGCctcgcagctccagcatcgtcTCTCTTCCTGGTCGTATCTGTAGGTGGAGCATTCTGCGTTGCGTTTG
CGTTTGCCTTGGCTTTTCGGAGCGCGATTAGATCTCGGTAGAGATCCTTCGCGTCAGGTTCGGGCGTGGTCTGTTGAGGTTTCGcccgaggctgctgcag
taccTGTCGGACTAGCACACCGTCCACTGactcgaggcgctggcctgTCTCGATGGCGCGTAGTGCTGCTTGCAACTGCACTAGCGTGTCCATGAGGAGG
CGATGTACGTCCCTTCaagataaaaaaaaaatggtttcaagttgaagcgaaCATTTGCTGTAGAACTTGACTGTTTACCATGACGACactttttttcttc
ttgtagCTACGAAACTCGCTCCCTTTGGTTCGGCTCTTTCCTCTTTCTACTCCACAATGTAGGCGACAGTTTATTTGTCGGCTTTCGAGCCTTGTTCCGT
GGCGGGGCGCACCGTTCCGACggtctgctgcttctcctgctgctgctgcatgctgtCGGCACTCTTGACAACgtggatctcgtccatcgaGTACTGGCAC
ACAGGCTTCTTGGGTCCATTGCCCAGAATGAGGGGCTTGTCGCCCTTCTGCACACCACGCGACCAACCGCACTCGGTGTAGTTCTCCGCACCAGGTTTCA
CGAAAATGTTGTGCAGgacggcctcgtcggcgtAGTTTTCGTTCATCATGACGATACTCACGTTCGGGTCCACGCGCTGGGC