Description :
From Genome Similarity Track
Location :
Scaffold_139:980- 2510
Transcript NameFunction/comments
Phyin_T30-4PITG_20370Amino Acid/Auxin Permease (AAAP) Family

Sequence
1530 bases(100 bases per row)
ATGACCCCGTCCGCCGAGCCGCGGCGCTCGGCGTTCTTCACGCTTGAGGACGCCAAGATAAGTTTCAGTATCATCTGCTGCATCTGCGGCATCGGCACGC
TCGCCATGCCCTCCAATTTCGCCCGTGCTGGACCCGTGTACGGCACCATTGCGATGCTTTTTATGGCTTTTGCCAATATCTATTCAACCGTGGCGCTGTC
CCGCGTCATCCTCGTAGCGCCTCCCTCCGTCCAGACGTTCAGCGATGTTGGTGAGTGGGTGCTCGGCAAGACCGGACGCTACCTCGTCAACGTGTCCCAG
TTGCTTGTGTGTCTGCTACTACCGTGCGCCTTCCTGGTGCTTGGTAGTACCCTCCTAGACGTGCTGTTCCCGGACTCGTTCAGCCAAATCTTCTGGATCG
TTTTCATGGCCGTCACGGCCGTGCCGGCCTGTTTGATTCCGACCCTCAAGGCCGCTGCGACCGTCGCGTTCATCGGATGTATGGGAACCATCATCGCTGA
CGTGGTAGGAATCTACGTCCTGGAATGGGAGATGCGCGGTCATCCAGCCGCGCCGTCCCCCGATATCTCGCTGCACCAGGTCCTGACGGCGTTCGGCAAC
CTGTCGCTGGCGTACGGCGTCGCCGTCTTGATTCCCGATCTGCAGCGTCAGCACTCGCAGCCCAAGCGTATGCCCCGCGTTATCGTGGTTAGTCTGGGCA
TCGGTTCGGCTTTCTTCCTGGCTGTGGCTATCGCTGGTTACGTAGCTGGAGGTTGCCAGCTTTCGGCTAACCTTCTCTTCTCCATCGTCAACATTTCCGA
CCCGTCATCGCCGTCTGCGCTGGGTTTCGTCCCAGATCACGGCGCTGTGATCATGGCGTACATGTTCATGCACCTTCACGTCGTGATAGTTCTGTCCACG
GTGCTGCAGCCACCGTTCTATATGGCTGAGCGTCTCATTCTAGGTATGCACAAGGACCCCGTCGATGCCGTCTCGATCCATCAAGAGAGAAAGGAGGAAA
ACGACGGATGGGAGGAGCTGCGCGAAAAGATGTCGACTAACGGCCCCGTACTCAGCGTCACCGAACGCGGCGCGAGAGACCTCGAGAGCAACGCCGAGTC
GGACATCGATACGCTGTCGAACTCTGCCAAGCGTGAACAGGGCGAGAAGGAACACGATGAGGCCCAGCTCTCAAACTACAGCGTCAATGTGTTCCGCTAC
GTCACGTTGCGTCTCGTCATCATGGCGATTCTTGTGGGAGCCGCAATCGGCTTCCGCTCGCACTTCCTGGACCTCGTGGATTTCACGGGCGCGTCGGCCA
TCACCGTGTGCTGCCTGGTGCTGCCGCTTGTGTTCTACCTCAAGGTTTTCTGGCGCGACTTGCCAATGTATGAGCGCGTGGTGGCGGTTGTGGTGATCGT
CGTGTGCACTGTCGTGGGTTGCTACGTTATGATCGACGCCGGCAAGAATCTGTTTAATCCTGATTCGGACGGCGTGACGTTTCCGTACTGCTCGGAGGAG
TATCAATCCGAGCCGTACTACGTGCGTAAC