Description :
From Genome Similarity Track
Location :
contig_115:980- 2395
Sequence
1415 bases(100 bases per row)
CTACTGCAACGTCCAATATATGTGGTGGTTGGACACGAGGGTCTGGAAAACCCTAGTTTCCAGGTGTTCAAGCCGATTCATAAAAATACTACTACCCATG
CGCTAGAATCCAGTGGAGAGTTTAACTATGCGTGGAAGGAAGCCAAGAGTTGGATGGCACTTCTTCAGCAGGACTGTCACGGGTCCGAGGAGTCCAGAAA
GCGACCGATAGTGTTATTTTACGGGCCACAACATTATGCGTGGTTGAAATTAGGCGAAGCGCCATCGGATGATGTGCTAGAGGAACTGGTAACATCGCCG
ATTCAGGTCTGGGAAAACGCATATGATCAGGATGTAGAAATGTCATCTGTTGAAACAGACTCAGAAGCAAAGGTGAACAGTACAGTTAGTAAGCAAGTAG
TCGTCAAGAACATGCCCACAGATGAAAAAGCAACGAATTCAGTGGAACCGGAGCGAGAGGATTTATGCGACGTGACACTACACAGTGAAGAACGTCAGAA
AGAATTGCGTGCGTTCCCGACACCAGGACCACATGGTCTATCTCCAGGACAGCAAAAAATGCTCATTAATGCTGACTGGGAAGATGACGAACAGGTCGAT
CTAATAGCATCCGCGCTTGGTGAAACAAAAGATACCCTCAAGGAGTGGCAAAACAGATTGTTACACGAGGGTATAGACAGAATAGACACTCCGGACGAAA
ACGACATTGACATGATATCACTGGACACCTCGGAGTGGACACCAGACAATGGTGAGGTTGGTTATGGTCCTGATAAAAACCGATCTCCTGTAGCTCCTGT
TCCAGTTGATCCACCAGACAGCCAGCATGCTCGATTCACTTCTGGAAACGGAAGGCGCAGTGAGAGTATTAAACGAGAAGAGTGGAACGCTTTGGAGGTA
GACTGGAATGATTTGTCCAATCTACCGTTCCCTCGATTACCTGCTGACAAAATGAAGTGGGAAAATGCTGTTCAGGCATACCCTTACGAGATGCTTATGT
GGTTGCAACGCATCGACTCGCCAGAGTATGTCTTGAGAGCACTGACACTGAATACCATCATGACCTGGACACGGCAGCTCCGAATCGATTGCCTTCTTAT
CGGGCTAATTGATCTTCAGTCAGAAGTTGCCAAAGCAAAAGACACTGGGATAGTTTTTGATGAAGTAGCTGTTAACTCACTGGAGTCATGGATCTCGTTT
ATTCGGGATCAACGAGCTGGGATGGAGGATGATGGCTATATTCACTCAAAGGATCTGTGGAGTAGCCTAAACAAACTAAAACCAGACAAAGTACCGCTGC
TACAAGCCTGTCGAAAAAGTAAAGCAGAAAAATTGGCTAGACAGATCCTTGCAGCGTATGCGTATGCTCCGGAACTAGCTTCAATGAATGACCAAACCGA
ACCCCCTATCAAGTC