Description :
From Genome Similarity Track
Location :
Scaffold_22:980- 2088
Sequence
1108 bases(100 bases per row)
TACCATGAAGGCGCATGGGAATACGCTGAACAAGAACGCGCCCACAGCTGACATCCCGTGGCTCATTTAGTGGTTCAAAGAATTTGCGGATGAAGTTGGC
GACGTCGCTCCTGTCCGCGTTCGCTTGCAGAAGACTGTTGATGGCAAAATGAAGAAGTTCTACAACAACGAAGATACCAACCTACTTTACATGGGATTCT
GTGTACGACGAGATGCACGCGTACGTCCAGCAAAGTCGGCTAAGTGTTAGTTAGCCTGCTCGCTCCACCatgaggaagctgctggctgaacactgtcctg
agattcgggtccgctcatcgcgttccaacgagtgcgacatctgcacgatctatcagtcgcgtattcgcggcggagcaacagctgaagagactgaagaaat
gggacttcgcactacatcggctcctgaaatgcgatctgtttgagtgaggacgttggtatcattttgttctaatcatgcgataggtatcattttatttacc
tggaggctttcgcaaagaataaacgaaagacaagactcaagttactggtctggaccctgaggtggacgtcgcggttgtagtgattgacttctctcagaat
ccggtggtgctgtcagtctcatccacgccgcctcaatagtatttctgctctctcattgtcagaaatggtttaggcatatcctacgaaaatgaGCGGATTC
AAACGAACTATGCGAATGATGAGACGGTCAGTGGTAAAGGTAGTGACCAGATTAACACAATGCTGCACCACTTCATCAGATCCTCCAAAGTGACAAGAAG
AAACTGGTTGTGTACGCAGACATTGCGACGGACAGTTTAAAATTTAATCTAGTTATCTAATTTCTGCTGGTCCAAGTGGATGTGCGCGTGCTTGAGCGCG
TCGACTACAAGTTTTTGCGTCAAAGGCCACACGAACTATTCGTGCGACCGAACATTTGGGCACATCCGCACGTTTGTAGCCCGTCAAGACTGCTGGACAC
TGGACCAAGTACTGGCCGCGGTGTGGGATTCCGCGTCTTCAAACCGAACGGTCCACATTTCGCATGGCGACGGATTCTTCAGGGGGTACATGCCCGTTGT
AAAATAGC