Description :
From Genome Similarity Track
Location :
Scaffold_3054:98- 3643
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3054-fgenesh-gene-0.0Serine/threonine-protein phosphatase

Sequence
3545 bases(100 bases per row)
CGACGGCGAGTGGGTCTCGGCATCCACGACGCGAAGGCTCTTCATAAAAGACGTATACTCGACGGCGTCCGCATCTGCTGACCCGCTCCCATTTCCGCTC
TCTTCCGCTTCGTTGCCCACGGCCGGATTTCGCCTGCGCACAGTAAACGCATCGGCCAATTGCTCGAGCTGCTCGTCTTGGAGAAAGCCATCGTGTTCCT
TGTCGATGCATTTCATCGCCGTGATAAACTTTTGCCTGCTCACGTATCCGCGGTGAGTCTTATCTAGCCGACGAAATACGAACTTGAGGTATAACCGCTG
CTCGTTCAACGCATTCTTGCTGCTGTCCAGCAGTGCATCGGCCCACGAGAGATACTTGTGGTTGACCGACGGACTGAGCAGTTGCGTCTCTCGGTCATCG
TTCTTGTCAGAGGTGAGATTCGAGTGGGAGGCATTGAAGCTCGACATCCAGACGCTGCGCTGGTGAGAGTTCTCAGTCGAAAACACGTCTTCAAACACAT
TCCAAGTAAGCTGCTGCTTCTTCTTCTTCTTGGCATCGTCATCAGCGGGTGCGGCCGAGACCCCATAAAACGTCTGCAGGATCGCCGAGTGCAACGCCCG
CGCACCAGTCTCATTGAGAGCGGGAAGCAACTGGATGGTCTGGGACGCCTTGAGAATGTCATCCGCATTGAGGTATCCTTTGCTACTCGCGTCAAAGTCA
CCAAAGGCTTCTTTAAGCGACTTGAACGCCCTGGATGAGGCCAATCGCGTGCCAAATTGCTGCAGCAAGTCGACCGCACGCACATCGTCCACGTCGAAGA
GCTCTTGGAGATAGTCCGAGCGGCTAAACTCGGCAAAAAACGACCGGAACTCTTCAAAGTCGACAAACCCGTCATTGTTCTGGTCCATGTGCTGCATGAG
TTCGAGGATTTGCTGCTCCGAGAGCGTGCTGCCCAGTCCCAGCTTGCCCTGAATTGTCGCGCGAAATACGTCGTAGGTGATGAACCCGTGCTTGAAAAAG
TTTTCGTGGCTGCGCTGCGTGGCAATCCCGCCAATGCTCTTGATGTACATGGGAGAGTTTTTGTCCAAATCGATCGCGCTGGTTCCTTTGCCGTTAGATG
ACTGCGAGGCCTTGAACAGATCAAACGCCGCGCGGATCTTCTCGGCCAAATCCATCGCACCCACGTCTTCGCTACTCTTCTTCTCAGCCAGTGCATCACA
GAAAGCCAGCCACACACGCCGTACGAGGTGACGGCGCCACTCGACACTTGCGAGCTCCACCGTGTAACGACCGAGAAACGCTTCATAGTCGACCAGTCCT
CCCTCGGCACGCGTACATTCGGGGCCAACCAGCTGAGTATAGTAAGATAGGAACCGCGCATCAATGCCGAGCACGTCACGGAGTGTCTCTTTCCACTGGA
GCTTGGTCACGGCACCCGAGCCAGTCGTATCAAGCTGCGTGAACGCCGCCCCTAGTGCCGACTTCTTCTCGCCTAGTAGCTCGACCAGCGACATCATCGT
GCGCCGTTCGAGGCGTCTCGCTTTCTTTCGCCACTCGTTCTTGCCGGCGTCGCTTAACTTTTGCAGAGGCTGAGAGTAGAATTGCACGACGTGGGGCTTT
AGATTGCCGCTCTCCACGACTTGGAGTTGAACAAATGCGCCCTTGTTGTTTTGTGAGCCGCAGTAGCTGGACGCCGAAAAGATCGTGAGCAACATGCCAT
CGTGGGTGATCTCGTAACCTTGCTCCTGGCACTCATGGGACCGAATCACAAGGCTGAGTTGGTTCAACGCGCAGAATTTCTTCGTGATATCTGGCCCAAA
CTCGACACCAGCTCCTCGCTCCGATGGTCTCCAGCCATCGCTTTCACGTGGATCGCTCCAGAGCAAATGTGTAAACAGTTCGTCTTCGCGGCTCGTGCCA
AGCGTCGGCACATCACGGCGGTGGTTGATTCTTTTCAGTTCTTCAATCGTGACATCCTCGTGGTAACTCAGGCCTCCATGCGTCGCAAACACTCGGTCGT
TGATCAGCGAGAAAATGGGTAGCAGCTCAAAAACGTCTTCAAACATCTGGAACAATTGCACGCACGAGTACTTGCGCGAGCAGCTAATCGCGTCGGCGCC
GTCAAATTGGATGCTTTCAGAGCTGTACTTGACGTAGATTTCGTCTTCGAAGCCGAAGTTTTCGTTGATCATGCGCTCTTCGTGGTTGCCACGGTTGAGA
AACACAAACTTCGGATAGAGAAGCTTGAAGCTGAGTAGCAAAATCATGACTTCGACACCGTGGGATCCACGATCTACAAAGTCACCATTGAACAGAAACC
ACGTCTTGAAGCTAGGCACGCCATTCTTCTCCAAAATGGTCAGCAAATCTTCGAGCTGCCCGTGGATATCGCCGACTACGATGAGGTTCACGCCAGCGGG
CACGTCGATGGTGTTCATCGGAGATGACGGCAGCGAGAGCAGCAGCCGCTGGGCCTCGTCCAGAATGTGGTGCACATACACACGATGCAAGAGAATGCCG
TTGCGGAACTGGTCGATGAGCTTCATGACCGTATCGAGTCGCAGCGGGAAAGCAATGTGCACACCGCGGTAGTGCTCCATGGATTTGCGCACCAGCTCCT
GCTCGTCATAGTCGTCAAAACTGAGTTGCGGCGTGTCGTAGGAATTGAGCGTTGGCACCATGGACGTGAGCTCACTGATGCTCGACGACTTGTTCAGGAT
GCGCACCATCTGCACGGTCTTCTGTTCTTGCACGGTCTCCAGCAGGTTCCACGTGCTGAAGTTGAGCTGTGCGCGGAAAAGCGTCTGCGCCAAATGGCGG
CGGATTGTGTTCTTGATGCGGTTCGCCGAGAGGATCGTGTCCGAGTACAACTCGACGTAGCCCAGCGCAGCACGGCGAACCTCTCCATTTTTCTCCAGCT
CAGCACTCACAAACGCGCCGCTTTGATCCGAGTCGTCGGTCGCGTCGAGCTTCACAATCTTCCCAGGGTACATGCCGTACAAGAGCACTCGGGTGCCGAC
CTTGAGTTCCGACTGCTGGATCTTGGCTGGACTGCAGTCGCGGCAAATGCGCACAATATCGTAGTAGCCCTGCATGGGTAGTCGGTTCACAAACACTGAG
CACTCCTCGCACATGCACGTGCCGCACTTGCGGCAGTGGTGTGGTCGGAAAAGCAACGTGAACTCTTGGCGACAGACCAGGCAGTGCGGCGTGTTCTGCA
TCCAAATCGGACGCAATGCGAGTCGAAACGCCTTCTCCCACTTGACGTACGTTGTATCGTTGGACGCGCGCAGCTTCCACGACGTGAGCTGACCCGTGAG
CGAGTATCCTGTGAGATTCATCTCGAGCTTCTTGCGGTTGAAGGCCATGCCGCGCTGGATCGCAGCGCCATCGTACTCGTCATCTTGGCGCACAAGCTCC
TTGCCAATAAGCGACACGTTCAGCATGATCACACCGCGCAGGTGCTCCGGCGTGAGCGTGACGTGGACGCGGCGCTGACCACCATTCGTGGGCGAGTCCT
TGGGCATCGGCAGCTCGTAGTAGCAGAAGCGACCATTGCGGTAGA