Description :
From Genome Similarity Track
Location :
Scaffold_1075:98- 2311
Transcript NameFunction/comments
g9176.t1hypothetical protein

Sequence
2213 bases(100 bases per row)
CGGGTGGAGCAACTCGCCCAGGCGGTTGATCGTGACGAGATCGCCAATTTCCCCCTCATCAGTTACGATCACGCCTGCTTCTCGTTGCAGTGCCGCACTT
GCCAACCGATCGGCGCTCTGATTCCAATCGCGCTTCACATGGAGGAATTCGTGCTTCGGCCAGGATTTCACTTGATCCATCGCTTTCTGACGTAGTATCT
GGAGACCCGGTGCCTTGCAATCGATTTCACCACGCATCTGTCGGATGATCAGATTGGAATCTCCGCAGATCACAACTCGCCCCCTGTTCTGATCGGACAG
TAGCTTGAAGCCTAGCAGAAGTCCGCGATATTCGGCTTCGTTGACAGTCAGGTCGTCGGCGAATTCGGACGCGGCAGATACTCCGGGAGCTTCCAGACAA
TTGCACTATACGCTCCGGCGCTCCGCTTGACGCGTGCTGACCCATCAAAACTGACGACGAGCAACTCTTCATCCAGCTCTACCGTCGGCGGGGCCATCAC
GATCGTTCGTCTGGGCTCTTTCACCGGTGCAATCGCGATCAAGGCCTCGTCCACTTCCGCTCGGGGTGTAATGCTGGCGGCGATCGCGCCCAGGATTTCG
TCCTCTCCTTTCAAGCACTTCCGGATCTCCAAGGTCCACTCGGACAGCAGAGCTGCCCATCGTCCCAATCGTCCCTGGAAGCCCGACGCATTCAGCAACC
AGGCGAGCGTCGAATACCTCGACAGCACCTTGATCGATCGGTTGGTCAGGAGTGTGTAACACACGTCCGAGATCCGGAGGAGCGCCAAAACTTCCTTGTC
CACTATGCCGTAATTCAATTCGTTCGACTTCAGCGTACGACTGGTGAAGGTCACAGGCCAATACATGCCATCATGTTCCTGAACCAACGCAGCTGAAATA
GCCCACTTGTTGGCGTAGACCACGATCACAGGCTGGCGATCGGAATCGAAGTGTCGCAAAATGGGGGTGGTCGCAAGCTTGGCCTTCAGTAGGTCGAACG
CCGTCCTCGCTCTAGTCCACCGATCGTCGGACTCCGGTGCTCGGTCCTCATGCTTCCCGTGGTGCATCTCGTAGAAGTCCACTTCTCGCAGTTCGTATAA
GATCGCGGCGTAAACGGCGAAGTCTTCAATGAAGCGACTGTAATAATTCAGGCTTCCTAAGAAGGACTGCATCGATCGCAACGTCTTCGGAAACGGCAGC
TTCTCCAGCGATTCCAGATCTTTCGGATTGGCTTCCAAACCATCGGCCGATACCCGATGACCCAAGTACTCCACCTTCCGATGTCCCCAGAAACTCTTGA
CCACGCTGATCGACAGGTTCCATCGTTCACAAGCGTCAAGCAGTGCCTCGACCTTCTCGCAGATCGAGTCCCAGGTGTCAGCGGTGATCAGGATATCGTC
GATGTACGATCGCCTGCCCAGCACCGAAGGTCCCGGGTTTGCCTCGGGTTTCCATTTCTCGAACACGTCGGTTGGTTCCGCGTGGTCTCGATCAGGACTT
ATCCGGAGGTATCCGTACAGAGCATTATCGATCAGCCTCTGGTAGATTTGTGGGGCGTTCTTCAGCCCGAAGGGCATACGCGTCCACTCGAAGAGTCCGA
AAGGCGTAACGAACGCGGAGATCTTTCGCGCACGTTCCGTCATTGAGACCACTAGCCATATCCAAAGAGCAGTATCAGAGTACTTTGTCCAAGTCCTCCA
AGAGATCGTTGATCAGCGGCATGGGATATACCATCAACCTGGTCAGGCTATTCACCAAACGGTAGTCGATGCACAGCCGGATGTCGACTCCATTCTTCTT
AATGATGATCACGATCGGGGATGCCCATGGTGAGGTTGATGGCTCAATCATTTTCGCGGACAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGAAT
TGAGGGGCCACCCTCCGCACGCGTTGGGCGATGGGAGCGGCTCCCCCAACGTCGATGTCGCACACCGCACCAATCGCAGCGGGTGGAAGGGCATTCCCTT
TACCGATCAGCAAGTGTCGTCGCCGCCAGATGATCTGGCGAAGTCGATCGATCTCCTCGGGTGTATTCGTTTCCGGATCACCTACTTGAATGTCTTCGAT
CGTGACTTCGTCGGTAGTGATCGGCACTTCGGGTAGGATAGCCATCTGGCTTTCAACGTCTTCCGCAAACAAGGCACCACCTTCATGGAAACACACCTCT
TCGTCTTCTGGAG