Description :
From Genome Similarity Track
Location :
Scaffold_3102:98- 1918
Transcript NameFunction/comments
Phyta_totarag15071hypothetical protein

Sequence
1820 bases(100 bases per row)
TGTCGGTTGTGGGCTCGGTGTACGGCTCGCTCGCGTTCGAGTGCTCGCTGCCAGTGTCCGGCTTGGTGTGtgtgctgtcgccgctggctGTGTCGGTTGT
GGGCTCGGTGTACGGCTCGCTCGCGTTCGAGTGCTCGCTGCCAGTGTCCGGCTTGGTGTGtgtgctgtcgccgctggctGTGTCGGTTGTGGGCTCGGTG
TACGGCTCTTGTTTGGACTTGCCTtccttgagcatcttgaaAGGTGTCTAGTCATTTCTTGGAAGTCTGAACTACTATCATAAGTTTATTGAAGACTTTC
CGGTGGTGGCTGCCGTTGTGTACGAGCTTACGGACGAACAAATACGTTCCGGACAGAACATGCACAGAGCGAAAGAATCATTTGAGAGCCTGAAGCGAAA
GATTGTTTCAACGCTGTTGCTACGTCATCCTGATCGGAGTCGACCTTTCGTCATTATTCCGCACGCGAATCAATGGGCAGCATGTGCAGTGTGGGACAGG
TCTATGATGGAATCATCCGACCGGTGCGTTTTACTGGTCGTGTCCTGAACGATACTGAATTCCACTACCATATTGCGGAAAAGGAAGTCACCGCAGCGTT
GAGAGTGTTGCAGATCTTTCGACCATTGACCGAACACTCGCGTTTGGAGATCTACACTCGATACTCGGTTCTGAAATGGGTCCTCCGTTCGAAAACGGCT
GATGGCCGATGTGTACTGTGGGGCGTCGCTTTGTCTCACTGGGACATTGAAGTTCGGAAATTGCAACGGGATGAAGATGGACTAGCTGCCATCATGGGAG
CCGGCATCACGCCACGTGAGCATTTAGATGAAGTTGCCGAATCACTGATTCCAGCCAAGGGACACGTCAAGGCACCGCCGGTTGTCAGTGTGGAAATGCT
CAGCGATGGTTACAACGGTGTTGTTCTCAGTTTCGACGGTGCTGCTAAGACGTCGACCCAACAGGGAAGTTGCGGCTGTATTTTGTGGCAGCGCCCCGGG
TGGTCCGTTTTAGACGCCCGCGGTTATATTCTCGAAGACGTCACCGTAAATGATGCTGGATATCCTGGACTTCTGAAAGGAATGGCAATGGCCTCCGAAC
GGAATATTAAAACTCTGGTAGCTGTTGGTGATTCGAGGATCGTCATTCAGCAAGTTTAGGGTCTGATCAATTGTAACCAGCCCAACTTGCAGAGACGTCT
AGCCGAGTGTGAGGTTCTAAAAGCGAAGTTCGAGTCACTCAAACTGGTACATGTCAAGCGAGACTACaaccaagctgctgactACTTGATATCCAAGACT
TTAGCTCTTGGGGGGTCGTGAGCGGTTCAGGATGAAGCAGAGCTTGCACAACTGGAACATGTGTCCAAGATTCCGGAgaagctgatgaagacgataTCCG
CCCCAGACGGAAATGTGGCTGCTGAAGGGGTCCATCCGAACAGTGATGTCGGAATAGGAGGCCCTCAGACCGAAGCAATCTCCGCTGGACCGGAGTCTGA
ACCACTTACGCATGCTGCAAAAGTACTGGCAGTCCTGACCCGGTCGGGTGCTCGAAACGAAGACAATTCGGGTGAGCCAATGAACCCGCTCGAATACCAG
TCAGAACGATGGCGACGTATCAAGGTGCATCAAGAAGACGACAGTTACTTGGCCGAGATAAGAGCTTTTCTGAAAGGGGAAGTAGAGCAATTCTCGCCTA
GAAGACTTAGCAAAATCGCCAAGATATCGGACTTTTTCGCTCTGGACACGAGAGACATGTTGTATCGGCTCGCACGGTCCACTCGAGATCGACCTAGGGA
TGTCGTATCCGAACCAAGGT