Description :
From Genome Similarity Track
Location :
Scaffold_7:979898- 986778
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05338hypothetical protein
Phypa_INRA-310PPTG_05339DC12 family protein
Phypa_INRA-310PPTG_05340hypothetical protein
Phypa_INRA-310PPTG_05341DnaJ subfamily B protein
Phypa_INRA-310PPTG_05342hypothetical protein

Sequence
6880 bases(100 bases per row)
CAGAGTACCATTCGTGTAGGAGCATGCGTGCTAGTGCGTATGTGCACTCGGTCAAAAAGTGTCGGAACATGGAATACACTCTATCGATATCATCAGCTAG
AACGTCATTGCGATCTTCCCGCCATTCCCTGGATATGACGTAAATGCACTGAGCACCGATCCAGTCCTTAAAAATTAAACGACTTACTTATCCTTTCGAA
GTGTCTGAAGAAGACGTTTGTGGTGCTTGACCAACGCAAAATACGGTAAGCCATCACGTGTGTAGATGGATTGAACAAGCTCAGCACTCAGCACGCGAAA
CAAAGGTGCGTATGGGCCGAAATGCGGCGTGAGATCTTCTATTCTTTTCGAAATCGAAGATCAACATAATAGAGTAGTGAATTACGAGTCTTTATGCGGA
TCAATACAGTGACGACAATATTGACGGAAACTTACCAAGAACTTTGCAGCAAAAGGTTGTGATCAATTCGTTAGGTCGCGGAAGGTTAGCTGTCCGTCGC
TGCAGCTCCTCGAATCCTACCTCGTACCGGATGGCTAGTAAACCACCGTCGACAGCATTAAAACTCGCACAACAAAATATCGTTAAAATTACTCAGGAGT
TCCCTACCAACAGATTTAAAATTGCGTCGATCGGCTTCAAACTGTCGAAGCCATTGGTCCATGAACAAACGGGCAATAGCTGATTGGTTGAGCTCCGCCA
ATGGGTCCGCCTTCACCGCATCATCCATCGTTTGTATCAACTCATGTAGAGGCAGCTCTGCACCTCGAGGTAAAGTACTCGGCGTTGTTGTGGATGTAAC
TTGATTAGAGAGTTCTGGTTCAATGTGGTGCTCCGTTCTTGTCAGCATCGGTAGCTTGGATAGACGGAGTGATCTCTTTGGAGAAAATACACCCAATTGG
AGTTTTCGCCGCCTAGGATTTTGCTGTTGTTTTCCATTGCTAGCACCACCTCCAGCAGTGCTCGGCTTCCGAGCCAGGAACGTTAACGGATTCACGGTAT
TGGCTAGACCTAATGCATCAGGGCGGGCCTTGATACTCCTCACCTGCGGCTTGACAGAGTACCAGTCACATGGCAATGTAGCTGAGCGGCTTGGAAGCCG
CACTCGAGGGTTCTTGTTGCCGCTGGAGGCTCCGAGGTGCTGCATACCTTGGTGCATTGTTCCATAAACGCGAACAACGTTATGTATTTCCGAGTAAAAT
GGGAATGATGAAAACGTAAATTATCAGATCAATGTGTACATTTTGACCAATAACAGTCGAGTAACCCGGTGTTGGGTTACTCGACTGTAGTAATGTGTTC
TTACAGTATCCTCACAATTCATTTTGGGCATTTCGCATGTGTGGGCGGGCACGGTGCACATTGGCGCGCGAGGAGGTGGCGGAAGCTGCAGGCGTCGCGC
CCGACGAGTTTGTGGATGGAAATAAATGTATGAGGAGAAAGTTGAAGCTCGCTGCTGACTGAAGGCGTGCTTTGGCTGGCTGGAAGTTGCAACGAAATGC
TAACGTTGTGGTCACTTTTTGCCTGTGATTTTTCTACAGATAACCCCGTTGAGAATATGGGACCCGGAAGATACGGCCCGATCCTTTTGCAATGTGGCGG
AGCAAAGGTGGAAGGCGAAGCGAAGATGAAGACGCGACTGCAGGCTATGCGGGTTCGTGCTGGGCTTTGCTGCTAATAATGCTTGTTGACACTTTTTTTT
TAATACTATCTGGGTCCTTTGTTGGCGGATTATACATATAGTGGGGACTAGTTCCGTCCTTCACGAAGGCGAATGCAAAGCCAGACCACTTCCTGATGTT
TAACGCTAGGTACAAAAGCATCACAATGGAAATTACTGAACCGAACGTGACATTAATTTTTTTTTTTATAATGTCCGTATTACTACAGATCCGAAAATCT
ACGGGAGCGGCCAGCTTTTAAGCGATTGTTGGAGTCAAAACGATGTGTGGTGCTATGTGAAGGGTAAGTGAGGTAAATAATTGCTTCTTTGAAGTTGTGC
TCGGTAAAATTATCGGATACAATTGTTACTGATATACAAACAGGTACTACGAGTGGCAGCAAGTGGATAAACGCGAGAAGCAGCCGTATTACTTTTATCG
GGAGGGCGTTCCAATGAAGGTGAGTTTTTTTTCCAGTCCGACGAGTTGTATTCGAGGTAGTTGTATTTGACAATCCAAGTGTGTTCAGTTTGCAGGCCTG
CACGATCAGTGGAAGAATGAATCAGGAGAGTTGATGTGTACCTACACCATTCTCACAACTGCGGTTGCTCCAGAGCTTAAGTGGTTGCACACCCGAATGC
CGGTAGGGAGAGTCGCTTGGAATATCCCACCGCCGAGACGATCTAAAGTCACGTGTGCCGTACTGCATCAGGTCATTTTGTCGGATGAAGGAGTTGATCG
GTGGCTTTCGGGCGCGAAGTTTGAGGATCTCAAAGACTTACTAGCGTCATATCGCTCCGCTGATTTGAAATGGCATCCGGTGGACAGGAAGGGTAAGCTA
CAGTCTTAGCAAAACTATACAGTACTGCAATGTTTGGTGGTCGATTTTTCACTGATCGCGTTCAAACGGTGATAACAATGTTGTACTGCAGTTGGATCGA
TGCAATTCCAAAGCGAGGACTGCGCCAAGAAGGTCAATATCAAGCATGCAGGTATGCGTTGCACCCCCTTGCTAGACACGTACACTACCAAGGTGACTAA
ACTTGAACCTCTCGACTTGACTCTAATTCCAGGTGATATTAAGGCCTTTTTCGGAGTTAAGACAGAAAAACAAGAACCCAAGATATCTTCTCCAGCTACA
TCAGGGAGTCAAATCAAGCCTGAGGAAGAAACATGCAGTGATACTGCTGCCGCAAGCCCCCCGTCCAAGAAAGAAGAGCACGACAGCAACGCAGACACAA
CACCCAAGAAAGAGTTCGAACAATTCCCCACCAAGTTCGTTCCAGCGTCAGCGCTTCTCAATAAACACTCTGATGACGAATATCAAGACTCCCCGCCTTC
AAAATCTCCCAGCAAACGCCGCCGCCTCTCGTCTCCAACCAAATCGAAGTCTCCAGCCAAAAAGAGCAAGCAGCCAGGCCCAAAACAGTCATCACTGGAT
TTTTTTTTCGGCAAGGGTTCGAAATGAAAGTCCTTCTTTTAAGTTCCACTCAAAAACACCTTTGACTTATCTACTTTCGCTAATTGCATTCTAATATAGC
CCGAGGTGCCAACAAATCAAAACCAAGAAGCAATGAGAGTAAACTACCACAACTGCACGAGAGAAGAAGAATACTGCGAGTGCGGATCGTCTTACCTATG
ATTGTTCGCAGTGCCGTGTACGAATGCAAGCGCTACTCCTCAAACGACTTCCAGCTGGTGATCGAATGCAGCAACTACTTAAAGCGCTATCTCCAAGTGA
ATCTGGGAGCGACTGGAAGCAGCATGACGAACCTACTTGCCTCTGTGACGCAAATCAGTCTCGGATCGAGTCCATCCAGCGCAACAAATTGGTTCACACA
TCGGGCATGAAAGGACTGCCCGACCGTGACCAGTTCATCCAACATTATGAGAACGAGATGCGGTTTGACTATTAGAAGTAGCGTTATTATTTATTTATTT
TATCGAAAGCCGATTCCAAATTAAACATCTACTTGAAAAATTCTGATGAGTCAGAGAACTCCGCTTATTGCGACCCCTACGTTTCAAGATGAACCTCGTG
ATGCCCATCAAAACGGTCATAACAAACAACCAGTATCATCGCCTTGTGGATTATTATCATAGCTGCCCACGTCACTTTCGTGCTAACCAAAGCATCGGTG
CATCAAAACGCCACTACGACCAATACCGGTATTCACTTGTGGGAACGACAATGCAGTATAGTTTGTATTGCTGTGATCGAAAGGATACCTGCCAGTGGCA
GGCTGCCATCAGTTCTAACGATAAGTATGCGTACGTTAATAACGTTTTTTTTATTCAAAGCAGTGTTGATCAGGATAGACATATTGGATTCCATAACGAA
GACTGCATCACGGAGTACAATACTGAAGTATCAAACTAGGGCCTTTCAACTCCATTCCGTTATCAAATGTGCTAGGGCCTTCTTCGGAGTGCAGGCAGAA
AACACGGGCCCAAGGTATTAAATCCACCCACGCAAGCTCAAGTCCACTCAGATAGGAAACATCCAGCGATACTGCCACGCGTTCCCTGCCCACGAAAGAC
AGGATGACTTAACCTCGACAAGACACCCTGAAAACCAAAGCCTCCTGGATTCTCAGCAAATGCTTCAACAATGAAAGGCAAGACTCTCCACCGTCAACGA
CTTCCAGCAATCGGTTGTTCGTCTCCAGTCCTAAAAGCACATAAGTTGAAGGCTTGCTTGCCATCGGGTGACAGTATCGCTATCACGGCCGGGAAAATGA
GCGTAGGCCAAAAGAAGAAGAAGAAGAGCGATTGCTGTTAGGTGGCGCCCAACGCAACGGAGTAGTAAACGTGAGCCCAGGAGCTTATTAGTGCAATCGA
GTATAATTACATCTACAATTACGACTTGCAATTTTGGGCATTTTTTCGGCAAGGGTCCAAAATGAGACCCTTTTCAAACTAACATACCCTGCCTTAAACA
TTTTTTTGGAAATGTAAAGCCTCTTGAATTAAATGAAGTCCCCCTCAAAAACTGTTGACCTCCATTCCGCGATTGCCGCGGTCGTCCGAGCTTCGGCGTT
GTCAACGTTTCTTGGCCGCCACTAGTTGTCACTTGTCCGCACCAGTGGCATATTTATCTTTTACTGTGTCTTGCGCGTGCGGTGGTGCAAATTACAGCTC
TATATACGCAGTATACGTCTCATAGCTACAGACAGCTCCGACTTCCAGCATGGAGATGAACAAGGGAGAGGCCGAGAAATGCCTCGAGATCGGAAAGAAG
CACTTACGTCTCGGTAACTGGGAGAAGGCCATCAAGTTCTTTGAAAAGTCACATCGTATGTATCCGCTGCCAGGCGTGGAAGCGATGCGTGATCGAGCCA
AGGCCGAAATGGAGAAGGCGTCGACAACCAGTGCACAGCCCACGTCGCCACGTGGCGCGTCATCAAATGCTGGAATGCGACACCGATCAACTCCAGCCGC
GCCATCGAGATCTCCGTCATCGGAGCCCTCGCGGCCGTACACGACCGAGCAGCTGCAGATGGTGCGCAAGATCAAGGCTTGTAAGAATCATTACGAGGTG
CTGTCCGTGCAACAGACTGCCACGGATAACGAGGTCAAGAAGGCCTATCGCAAGGTGAGCGTTAAATATTGCCGGTTAAATGATGACGTTTAGCTAACAT
ATTGCTGTTGGCTGTTGTATAGTTGGCCCTGAAGCTGCATCCGGACAAGAACAGCGCTCCAGGAGCGGAGGATGCGTTTAAGGCTGTAGGAAAAGCGTTT
GCGGTTTTGAGCGACCCCGATAAGCGCGCACATTACGACCGGTATGGCGATGATGCGCCCGTGCAGCAGCAACAGCAACATCATGGACGTAGATACGCCC
AGGAAGACGATATCACACCGGAAGAGATTTTCAACATGTTCTTCGGCGGCGGCTTCCGTCCACGTGGACGGCGGCCACAGCAGCACCAAGGCCATGGACA
TCAGCAGGAACAACGTGGTGGTATGGCCAACCTGGCCCAGTTCCTGCCACTGTTGCTGATCTTCCTGATGTCGCTGCTCTCGATCCCATCGACCCCCGAA
ATGCCGTTTAGCTTAAACCCGACGCCACAGTTTAACGTCCAGCGTGCGACGCAGATGGCCAATGTGGTGAAGGGTATCCCGTACTACGTAGAGCGCGATT
TTGAACAGCGGTACACGACCCACTGGCGCGATCTCTCACGGGTAGAGCAAATGGTGGAGCAGGCACATGTGTCGAAGCTGTCGGAGAGCTGCGAGAACCT
TAAACTGCGGCAGAAACGGATGATCTACCGCGCCCGTAACTCTCGCAGCGAAGACCGTGAAGCCGCAATGCGTAAAGCGCTGGAAATGAAGATGCCTCCG
TGCGACGAACTGCGCAAACTCCGACGAACGCGACGCTATTGATCACGGAGACATAACCGTACGCAGGAGATCTACAGTCAATCATTCGGTTTTAGAGAAC
GGAAATGGGGACGATATGTAATCTCCACGTTCGAGATAATAGGACACCGGCAGTCGGGCAATAGCCACCACGTCAATACACATATGAAGCAATATCTACT
CGGGGCTGTCAATCTTTTCTGCCGAGTGCTTGATGCTCACTGAGCCTTGCTCAGTGTTGGCAACTTTGTCTTGAAGTGCGTAGGTTCAGAGTATTCCTTC
TCAGAACAAGCGACAGTATTGTCTAGTTTAATACATATTTCCCTCTAAACAGTCATCGTCATAATCATCGTATCCGCGACATTCCTAAGTTGAAAGTCGA
GCCAGGACCGACAAGGGGACGAGACGAGAATGGCGTCGAATGAACTGGCGGCGATCCTAGCACGGCGCCGCGCCAAGGCCGGAGGGGAGAGCGAACCTCC
TGTTCCAGCAGTGGAACGTAGTGCTCCCCCTGCACCGGAGACGGGCTCGTCGGCTGCTAGAAGCTCGATTGCGGAACGGATCGCACGCCTCAAGCAGCAG
AGCGCGGCCGCCAGCGCCGCTGAAGGAGCGCCCCCTGCACCACGATTCAATCACCCGTCACCAGCCTCGGAGCCGTCGGAACAGCTTCTAGCGAGTAACA
GCAGCGTTGGTAGCATGAGCGACGCGAGCGTAGCGTCAGCGGCCTCGGAGCCGGTTGACACGTCCGCAGTAGTGGCTGCACAGGAAGCTGCCGGCATCCG
TAAAGCTTCCAGTAAGATCCAGCAGCTACAAGGCAGTCTGGGGATTAATGTGAACCCATTCGGACGTCCGGGTGGAGCTC