Description :
From Genome Similarity Track
Location :
Scaffold_281:9798- 11913
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_16371glycoside hydrolase putative
Sappa_CBS223.65SPRG_16372Hypothetical protein

Sequence
2115 bases(100 bases per row)
GTCCTTCTCACCAGCGTACGAGCTGTCGGCGGCCGCATACGCGAGCGGGAGCACGCGCATGTTGGTCGACTTGGCACGCATCCAGTTCTTGACGTCCGCA
ACGTACTGCTTGACGCACGCGGCGGGGCGCAGCGACATTTGCATGACCTCGTTGGCCATGACCATGCCGAGCGTGTTGTTGAACTGCGAGAAGGCGAGCG
CGATGCGCTTGCCATAGTCGAGCAGGTACGACGGGTAGCACGACGTGGGCTGGCTATCGGCCGCGAGGTTCTTCGTGATCGTCGAGTACATGTACGAGCC
AAAGTACGCGACGTTCGAGGGCGACGCCGACACCATGACGTAGATACCCTCGGCCTCCATGTCGGTCATAAACTCCTTGTAGCTGTTCTCTGGGTTGACG
TTGTAGATGCGGAGCGTGTTGAGCGTCCCGTTGAAGTCGGTGACGGCGCGCGCGATCGCGGCCTTGGAGTTGGCCGCATAGTTCTTATCGCTCACGTCGT
ACTCGTACGTCATACCCCGCATGAAGAAGCGGTCGCCCGTCTCCGAGTTGTACATGTAGTTGCCGCGCACGATGATGGGCGCGAGCGCGGACGCGAGGTT
CACGGCGAGCGCCGGCAGCAAGACGAGGAGCGTCGCAATGCGCATGGGCTGAGGTACTCCGGCGTCGAAGTGCAAACTGAAAATGCCATTTCTTATCGGC
CCTTCTATATTGGCTCGGGTTCTAAACGAATATAATTCGATTTTATTCCATTGGACCAAAAGCAATACAAACATCAAGATAGCTTGGAGGGCTGCGGAAT
AAAATCGACCTGGCCAAGGTATACCCACGTCCAGGACGTGACTCACACACCGTATCCGTAAGATACACTTTTGCACCAATCAAAAGCACAGACGACGAGA
CGACACCTCACGGCGACGAGCGGCCGCAGCTCAGGCCGCGCAGATTGTGCCATGTTGGCGCGTTCGATCGACGGCCTCCAGATGCGGCGATGGCGAAGAG
GACAGAGCTGCCTACACTGGCGCCTCACATTTAGAAGCGTCTGCGTAGCACAAGCTAAAGGTAGATAGAAGGTAGAGAGTATATCCTCCCGTACTAGGAC
ATTGCGGGAATGGACACGGGGCCGTAGGACTTCGATGGACGAAATGTGTGTGAAAATGGACAGAGATAGCCAAGCGAAGCGTTTGAATGTAGCCAATCCC
TCGCCAGACGACCATTGCATGTAGCATGTGCTGCAAAACTGCGTGGTTGCCCTCAGTGCACGCGGTGTCAGTTTGACTGGAATAAAGTATACTGTCCCCC
CGCCTGGCCTCAGTGAGGGCGGAATGGGCGGCGCTGGCGACTTGAAAAAATAAAAATTGTACCAAGGCCAAGGACTCACATGTCAAGCGTCGCAAAACCG
TGTTCATGGATGTTCGTGGGCGAGATGCTGCACGGCGTAATCGTCAGTCCTGCGAGGATACCGGTACATATTTGCAGTGACCGGTATCGATCAGAATTGC
CATCAGAACGACGCGTACGCTTCATGGGTACGCTGTCATGTCGAACACTGCTGGGTTTTTATATACCAGGTATCCCCTTTTGACGTGATATTACCACATC
GGCAGGACGGGGAATCGAGCTCTACCTGACCGCCACGATCGCGTCGCCACTCTCTCGGCCCCTGCCACCGCCGCCAACCCTACCCCGCCCGCATGAACCC
TAGCCCCATCCTGGCGGGTGTCACGTGTACGCTAGCGTATTAGATACATACTACACGGGCGGTCGTTGTCGTTAGGACCTCTATCTACTGCTATTTTTTG
GTCGCGTTGAAGAGGACGGTCGAGAGGCTGGTCGTGATAGCTTTCCCGAACGACGCGGTCGAGAAGCTTCTCCCTTTGCTACGTGACAAGATGTACATAA
ACACACGGTCTTATTCTATAGCACGTTGAGCAGAAGGCGGCTGTACCTTGGCGAGTGCGACGATGGCGATGTGGCCACCATGTGATTGGAAATGCGGTGC
GTGAGCCACGACGCCCACTTCTGGAACGGCAGGTCCGACGCGAGCACTTGCTGAAACCAGATCTCAAACATCTTGCGCGACGACGTGTCGAGATAGTACT
CTTCGGCGTGCATCT