Description :
From Genome Similarity Track
Location :
Scaffold_141:9798- 11326
Sequence
1528 bases(100 bases per row)
TATTGCGACGATATATTCGTCCATAGCCGCGCCGAGGGAGGCAAGACGGCCATGGAGGTGTACTTGGGTCGCCTCCGTTGAGTGTTGGATGCTATGCGAG
CCAACAAGCTCTACGCCAACATCAACAAGCGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTCAGCAACGCTGGAAATCGAGCTGACCC
CGACAAGATGAAGGCCATTGCAACGCTGGGATTCGAGCTGACCCCGACAAGATGAAGGCCATTGCAATGTGGCCGACACCCAGATCTCAAAAGGATCTCA
GGAAGTGGTTGGGTTTGGCCAACTACCTCCACAAGTACAGCTCAGGGTACGCGGGTCTCGCAAACCCTTGTCGGATCTCCTGAAGAAGGATGCCGACTGG
CGCTGGGAACAAACGCATCTTTGACAGCGTCAAGACCAGCCGGCAAGGGCACCGATACTGGCGTTGCTGGACGAGACGAAACCATTCAGCGTCATCTGTG
ATGCCTCCGACTATGCAATCGGTTGTGCACTACTGCAAACCGATGCAGCTGGACATGAACGAGTCATTTCGTTCCAGTCCAGGCAGCTCAAGGCTGCCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN