Description :
From Genome Similarity Track
Location :
contig_74:97968- 100869
Transcript NameFunction/comments
g11822.t1hypothetical protein

Sequence
2901 bases(100 bases per row)
CTGGGCCGTCATCGGGAAACAGTAGCAGAGGTCCGACAGAGGGAAAGCCACCCCCAAAGCCGCGCAGTGGAAACCCGCCTCGTCGTACCTGTCTCAAGTG
CGGATCGCAAACGCATTTGGTGCGGCAGTGCCCAGATGTAACCCCCGATGAAGTGGATAAACTCCTGGCGGCGCGAAATCCGTCGACCAATAGCGCGACT
AGCACTCACTTCAAGCGTGTGCAAGTTGTGAATGAGGACAGTGCCGAGACAGGTTGTGCGCAAGCAACTACGTCCAATCACCCCCTGCGTCACTCGATAG
GCTTAAGGGATGACGACGGTACGGCTCAAACGACTATTGACGGCTTTACTCTGCAGACATCGCTGCTAGATAGTGGTGCGGATGACTCCGTGGTCAGTGG
AGGGATTGTGCGCGCTTTGGAGTCGGCTGGTGTTCCTATCCTGACGTTTTCGGCTAACACGGCATTGGAACCTGTGGGTGGGCATTTGATCCCAGTTGCC
CGGAAAGTACGTTTTGGTGAAGTGGAGTTTGCGACCTCAGCAGGTCCACTACTTCTACGCAACCTGGATTGTTTGGTGCACGAAGAAGATCGATCGTTGG
CTCTAACCGTGGGCCGTCCAGTGATGAACCGCCTAGGTTACTCTACAGACGGTCTGCTCGCTGCAGCACGAACACGCCAGCCCGAGTACTGTCTCACGGA
ACCAGCAGAGGAGGACTCCGACAAGAACAACTCGCCGTTAGTCCGCGTACAGGCGATGCGAACTCGGCTCCTTGATGAATTGGACGTGGACGGTGATGAT
TTGGATGAACTTGTTGCATCTCCAAGGCTCGTCGCAGAGACCACGCGGGCCGTACAAGAAGCTCTGGAACTTAAAATACAAGAGGCGCGTGCGAATGGAC
TAACAAGCAAAGAAGGGGACGATTTGCAGGAGCTCCTGTTTCGCCACATCGACGTGTTCCGACTCTCATTTGGTGATGACCCGCCAGTGCGCGTTCCCCC
CTTCGCGTTCATCTGAAGGAAGGAGCTCGGCCTGTGAAGGCTAAAGCGCGGCGCTATCCGCCTGATCACAAACGGTATTTGGAGGAACACATCGAAGAAC
TCGTCCGTCACGGTTTAGTGAAGAAAAATCACCGCAGTCGCTGGGCGTCAGCACCTCGGATTGTGGCGAAACGGAAACCCGGGGAATACAGGATGACTGT
CGACACACGGGCCGTCAACGCTCTCACCGAGCCGATGCCGTGGCCTATGCCAGACATCGAGGCAGACTTGGCTCAAGTCGAGGACTCTGAAGCGTATTTC
ACGATTGACTGGTGGCGAGGATATTGGCAACTTCCACTGGATGAAGACTCACAGGAACTCTACACTATCATGACACACCGCGGGATGTTTACCCCGACCA
GAGTGTTGATGGGCAGTACGGATGCGGTAGCATACTGCCAAGGCGTCGTCGAGGAGATTTTTGGACCTCTTCGTGGCGGTCAGATCCTCGCCTGGCTCGA
CGACATTCTCGGATATGCTCGCTCGCCATCCGCGCTGCTGGTCGTGCTCAAGAATGTACTGGAGTTGTGCGCAGAGTACGGTTTGAAGTTGCACCCTCTA
AAGTGTTGTTTCTTCACCCGTGAGGCTACCTGGTGTGGACGAATGATTTCAGCACAAGGTGTTCGTCACTGCCCATCTCGGATTGATGGGTTGGTAAACT
TGCCGGCGCCACACACAGCAGGGGAACTACAGCAGTTCCTTTGTGCTGTAAATTGGATGCGTGGCAATATCCCCGAGTACAACGCTCTCACAGCAAAGCT
GTACGAAGTCCTGGAAGCGGCGGCTACTGTTGCTCAAAGTCGGAAGAAAACGCGGTTACATCGGGTGCTGCTTGACTCGGTCGGCTGGGGTCCGGAGCAT
GATACGGCACTGGCCAATGTCAAGGACGCTCTGCTCAAAATGGTCACATTAGCCCATCCGAAGGACGACTGGGAGGTATGCCTATTTGCTGATGCGAGCC
AAACTCATTTCGGAGCAGTGGTGTCGCAGATTCCACCGGAGGATGCCGGCCTGCCCATCGAGAAGCAGCGTCACCAGCCTCTCGCTTTCTTAAGCGGATC
ATTCACTGGGGCTATGGCACGCTGGTCTACGATCGACAAAGAAGCCTACGCGATTGTTGCGGCATGCAAACGCTTGATGTATTTGCTGCTTCGTCCGCGA
GGTTTCCGTATTTTTACCGACCATCGAAATTTGCAGTATGTGTTCGACCCGCTCGCGGTCAACAGTTCTCTCGGCCGCCATCAAGTCGACCGTTTGCAAA
GATGGGCAATGACTCTCACTGCCTTTCGCTACGTTATCGAGCATGTACGCGGGGATGAAAATGTGTGGGCTGATCTTTTGTCTCGATGGGGTGCAAGCGC
ACCGACAAAGGTAGCCTCCGCTCGAATGAGTACTTTGCTGGTGGTGAACCGAGTTTCGCCGCTGACAGAGCCGGATTTCGCTTGGCCTAGTGAGCTCGAC
ATCGTGACTGAACAACGTCAGCAGCTTGCAGCTCGAGATCCTTCCGATGCCCTACCTCTGTGTCGCTGGAACGACGAGATGGGTTTATTCGTGACGGAGT
CGGGCCGTATTTGGATCCCCGAACAGTGTGTCGATCTCCAACAACGACTGTGTGTGCTGGCACATGCCGGCCTTAGTGGGCATCGTGGCGAGGGAGTGAC
CCAGCAGATGCTGGCTGAAAAGTTCGACTGGCCTACTCTAAAAGCCGATGTGAAGGCGTTTGTGCGTGGTTGTCTCCACTGCATGGTCGTGGGTGAGCGC
GTTGTTCCTCGACCTTTTGGCCAAGCTCTCCACGCTTCCGCTCCCAATGAGGTTCTGCACTTTGATTTTCTGTCACTTCCGGCAAGTTCGACTGGTGAAC
C