Description :
From Genome Similarity Track
Location :
contig_74:97958- 99397
Transcript NameFunction/comments
g12379.t1hypothetical protein

Sequence
1439 bases(100 bases per row)
CAGTTGCCCGGAAAGTACGTTTTGGTGAAGTGGAGTTTGCGACCTCAGCAGGTCCACTACTTCTACGCAACCTGGATTGTTTGGTGCACGAAGAAGATCG
ATCGTTGGCTCTAACCGTGGGCCGTCCAGTGATGAACCGCCTAGGTTACTCTACAGACGGTCTGCTCGCTGCAGCACGAACACGCCAGCCCGAGTACTGT
CTCACGGAACCAGCAGAGGAGGACTCCGACAAGAACAACTCGCCGTTAGTCCGCGTACAGGCGATGCGAACTCGGCTCCTTGATGAATTGGACGTGGACG
GTGATGATTTGGATGAACTTGTTGCATCTCCAAGGCTCGTCGCAGAGACCACGCGGGCCGTACAAGAAGCTCTGGAACTTAAAATACAAGAGGCGCGTGC
GAATGGACTAACAAGCAAAGAAGGGGACGATTTGCAGGAGCTCCTGTTTCGCCACATCGACGTGTTCCGACTCTCATTTGGTGATGACCCGCCAGTGCGC
GTTCCCCCCTTCGCGTTCATCTGAAGGAAGGAGCTCGGCCTGTGAAGGCTAAAGCGCGGCGCTATCCGCCTGATCACAAACGGTATTTGGAGGAACACAT
CGAAGAACTCGTCCGTCACGGTTTAGTGAAGAAAAATCACCGCAGTCGCTGGGCGTCAGCACCTCGGATTGTGGCGAAACGGAAACCCGGGGAATACAGG
ATGACTGTCGACACACGGGCCGTCAACGCTCTCACCGAGCCGATGCCGTGGCCTATGCCAGACATCGAGGCAGACTTGGCTCAAGTCGAGGACTCTGAAG
CGTATTTCACGATTGACTGGTGGCGAGGATATTGGCAACTTCCACTGGATGAAGACTCACAGGAACTCTACACTATCATGACACACCGCGGGATGTTTAC
CCCGACCAGAGTGTTGATGGGCAGTACGGATGCGGTAGCATACTGCCAAGGCGTCGTCGAGGAGATTTTTGGACCTCTTCGTGGCGGTCAGATCCTCGCC
TGGCTCGACGACATTCTCGGATATGCTCGCTCGCCATCCGCGCTGCTGGTCGTGCTCAAGAATGTACTGGAGTTGTGCGCAGAGTACGGTTTGAAGTTGC
ACCCTCTAAAGTGTTGTTTCTTCACCCGTGAGGCTACCTGGTGTGGACGAATGATTTCAGCACAAGGTGTTCGTCACTGCCCATCTCGGATTGATGGGTT
GGTAAACTTGCCGGCGCCACACACAGCAGGGGAACTACAGCAGTTCCTTTGTGCTGTAAATTGGATGCGTGGCAATATCCCCGAGTACAACGCTCTCACA
GCAAAGCTGTACGAAGTCCTGGAAGCGGCGGCTACTGTTGCTCAAAGTCGGAAGAAAACGCGGTTACATCGGGTGCTGCTTGACTCGGTCGGCTGGGGTC
CGGAGCATGATACGGCACTGGCCAATGTCAAGGACGCTC