Description :
From Genome Similarity Track
Location :
Scaffold_140:97946- 99851
Transcript NameFunction/comments
g6738.t1POM76356.1 Putative Glycoside hydrolase [Phytophthora palmivora var. palmivora

Sequence
1905 bases(100 bases per row)
GGGCTGGACCACCGCCGAGATGCGTGCCTTCGTTGGTCGCATCCAGGAGATCGCCATGGAGGAGAACGGCGGCCACCCGATGATCTACGGCACGGACGCT
GCTCACGGCAACGCCATGATGATGGACACCGTGTACTTCGGTCAGCAGATCAACGCCGCCGCCACGTTCAACCCGGACCTGGTCTACGAGCAGGGCCGCA
TCACCGCTCGTGATACGCTGGCGTCGGGTATCCCATGGATCTTCGACCCAGTGCTCGACATCATGCACAACCCGCTGTGGCCGCGTGTGTACGAGACGTT
CGGCGAGGACCCGCACCTTGCTTCGATTATGGGTGCTGCCATCACTCGCGGCATCCAGAGCTACCCGGAGGCTGCGGCGTGCATGAAGCACTGGATCGCC
TACGCGTGGAACCCGACTGGACACGATAAGGACGGCGTGGAAATCTCGGACTTCGACCTGCTGAACACGTACTTCCCGTCGTTCAAGGCCGCTGTGGACG
CAGGTCTGTTGACCGGTATGGAGAACTACATCTCGGTCAACGGGGTTCCTGTGATCGAGAACACGAAGCTGATGACGAAGCTTCTGCGTAATGATCTGCA
GTTCGAGGGTCTGATGGTGACGGACTACGCCGAGATCAACCACCTGACCGAGTTCCACCGCACGGCTCGGTCTACCGACGAGGCCACCAAGTTCGCTCTG
GAGCGCACATCGATCGATATGAGCATGGTTGCCGGTGATCTTTCGTTCACGAACGCCACGAACAAGCTGATCGAGGAGGACCCAGCGATCGTGGACCGCA
TTAAGGAGTCCGTGCGCCGAATCATCAAGACCAAGCTCAAACTCGGACTGTACGACAACCCGCTCCCGGGCGCCGAGTACCTCGACTTGGTTGGCAACGA
CGACGACGTCGCCACTGCTCTTGACCTGGCTCGCGAGTCGACGGTTCTGCTGCAAAACAACGACACACTGCCTATCTCCAAAACCGCGTCGGTCTTCCTG
ACGGGTCCCAACGCCCACAACATCGGTCGTCAGTGTGGAGGCTGGACCGTTCAGGCCCAGGGTGTGTCCGGCAACGACATGTTCTCGCACGGCGTGTCGG
TGAAGCAGGGTTTCGAAGCCATCGCTGGCAGCGATGCTTTCACGTATTTCAACGGCCTGAACATCACCGGCAACTACACGGCTACTGACCTGGCCACCGC
CAAGGAGTACGCTACCAAGGCCGAGTACACGGTGGCTGTCATTGGTGAGGAGGTGTACGAAGAGAAGACTGGTGACATCAACGACCTGACCCTGCCTCTT
GGTCAGATTGAGTATGTGAAGGAACTTGCTTCCACGGGAACCAAGGTGATCCTCGTCCTGTTCGAGGGTCGTCCGCGTATCCTGAACGACCTCCCCGAGA
ACGTGTACGCCGTCCTGAACGGCATGCTGTCCTGCGAGCAAGGTGGCAAGGCTGTCGCTGAGATCATCTACGGCGACGTCAACCCCAGCGGACGCATGCC
TATCACTTACCCCAAGGACACTGGCAACGTCATGATCCCGTACCGTCACCGCGTGAGCACCCAGTGCGCCTCGGGCGATTACTGCGAGCCGCAGTGGATC
TTCGGTCACGGTCTCAGCTACACCGACTTCACGTACTCCGACATGAACATCAGCACCGCCAACGTCACGTCCAGCTCCGACTCCGTCAACGTGTCGGTGA
CCGTCACGAACTCCGGCAGCGTGGCCGGCAAGGAGACCGTGATGCTGTTCCTGACGCAGCCGTACCGCTCCATCTCGGTGCCCGAGGTGAAGCAGCTGAA
GAAGTTCTCGAAGATCAGCCTGGAGGCGGGTGCGTCGCAGACGGTGTCGTTCGAGCTGACAGCGGCAGACTGGAGCGTGTACTACCCTCAGATCGGCCAG
GGTCT