Description :
From Genome Similarity Track
Location :
Scaffold_6:979454- 983400
Transcript NameFunction/comments
Physo_129125reverse transcriptase

Sequence
3946 bases(100 bases per row)
CCACGAAGGGAGCGATCTGTTGTCGCAGTTACGGGATCAGCTAGCGCTTCTCCCGGAGGTACAGGATCTGAGCCCCGAATGTGACATTGACAAAACAGAT
GTTGGTGAACCTGGTGTGAGCAGACCGGATGATGAACACCGGTTGCGTGGCATTCTGAAGTACCACCGGCGAATCTTCTTAGGCGACGGCAATGCAGCGC
CTGCCCCAGCTCGTGGAGTCGTTTGCGATCTGGATGTGGGCAATGCCAAGCCGGTCGCACAGAGAGCTCGCTCGGTCGCACCGCATCTCGCGATGAAGGT
GTATGAGTTGCTGAAGAAGTTGCTGGAGACCGGATTGATCGAGACGTCCACATCACCCTGGGCTTCACCAATTGTGATCATGCTGAAGATAACTGCAGTC
GACATTCGGATGTGCATCGATTATCGACTTGTGAATGGCTTCATCCATACCCACTCCCGCTCATCGATGACCTTCTGATCGGTTTCGAGAGTGCGATGTG
GTTCATGAGCCTAGACATGGCCAGTGACTTCTGGGCGATCAGGATGACGGAGCGAGCCAATCTCATTTCGGCGTTCGTGTCGCCTTTCGGTCACTACCAG
TGGCGACGCATGTCATTCGGTCTGAAGAATGCTCATTTGGTCTACCAGCAGATGCTCAACAATTGCTTGTGGGGTTTTGTCCGGTTGCCGCCCGATGAGG
AAGCCGAAGTGGATCAGGACGTACTGGATTATCTGGGCTTGAAGCCGCAAGAGGACAATGTCGCGCTGAGCGGTACCAAATCTGACGAGGAGATCCTGTC
CGGTCGACAATTTCCTGCATTGACGAACCAGATGACCGTGTTCCAGCGCAATATTCCGGCACCGATGCAGATGGGTCCTGTCCTCGGACGGAGTTCGTAC
ATCGATGACATCGCGCACGGGGAGCCTACGTGGGATCAACTGTGTATCGACCTAGATGCACTACTTTTCCGGTTGGGGTACTGGAACATTTCGGTCAGCC
TGCCGAAGAGCGAATTCGGTAAGCGCTCGATTCCGTACTTATCACACGAGATCAGTGCTGAAGGGCTCTGAGCGACACCGAAGATCGTCAAGGGAGTACT
GGACCTGCCGTTCCCGTCTACTTTGAAGGGCATTCAGTCTTTCTTGGGCAGTCTGAATGACTACCACAAGTTCATCGAGGATATTCCGGTAGTGGCCGCA
GTCCTGTACGAGCTGAGCGATGATCAGGTGCGCGCCGGTCGAGACTTGTCAAGGGCGAAGGAGGCGTTCGAGATTCTGAAGCGGAAGATTGTGTCTACCC
CGTTGCTCCGACATCCGGACCGGACCGAGCCGTTCATCATCATCCCGCACGCAAACAAGTGGGCCGCCTACGCGGTCCTCGGACAAGAGCATGACGGACT
GATCCAGCCCGTGCGTTTCACGGGGCGCGTGCTGAATGAATCAGAGATTCGGTACCACGTCGCGGAGAAGGAAGTCATTGCGGTCATGAGAGTGGTGGAT
GTGTTCAGGACGATCCTGGAGGGGTGCCGTTGATTGTGTACACCCGCTATTCGGTACTCAAGTGGGTGATCCACTCCAAATCTGCGGATGGACGCTGTGT
GCCGTGGGGCGTTGCGCTATCTCAGTGGGATCTGGAGGTTCGCCGTGTCCAGCGAGACGAAGATGGTCTGGCCGCTATACTCGGTGCGGGTATAACCCCC
TGGGAGCATCTGGACCGGATTGCGGAGTCGCTGATCCCAGCCAAGGGGCGCGTCAAGCCGCCGCCGGTTATCAGTGTGGAAATGCTGGACGCCAACTTTG
AAGGGATCGTGCTAAGTTTCGACGGAGCCGCGAAGACATCGACACGTCAAGGGAGCTGCGGATGCATTCTGTGGAGCCTACCCGGTTGGGACGTACTGGA
GGCACAAGGCTTCATTCTGAACGATGTCACGGTAAACGACGCGGAGTATCACGGCTTATTGAATGGGTTGACAATGGCACTTGACCGTGGGATAACGGAC
CTGATTGTGGTTGGAGACTCTCGCATCGTGATACAGCAGGCCCAAGGGCTGATCAATTGCAACCAGCCCAACCTGCAACGACACTTGACCCAATGCAAAA
CTCTGGAGGGGCGATTCAGTACGTTGCGACTGGTTCACGCTAAGCGTATGTACAACTCAACCGCGGATTGCCTAACCTCCAAGACACTAGCGCTTGGCGC
CACGTGGACCGTACAGGATAAAGAGGAGCGAACCCACTTGCAGCGAGTGTCAAAGATCCACGAGAAGCTGATGAAACCGGTAGTTGTGACACCGGATGTA
GCCGAAGCTGGTCAAGACGTACCGAATGGAGATGCGACCGAGGCAGCAGCGACACCGGATGAGGTGACACCGGACAGTGCCGAACAGGATCCTGAGTCAG
CACCACTGCACAACTGTGCCCGAGTCATGGCGGTCTTAACCCGGTCGAGAACCCAGGAGCAGACTGAATCCAGCGAGCCATTGGGTCCGCTGGAGTTCCA
AGCCGAACGGTGGCGCCGAATTAAGGCGCACCAGGACCAGGATGAGTTCATCGCAGAAGTGAAAGCGTATCTGAGTGGAGACCTGGAGCGATACTCTCCC
AGGCGACTGCGGAAGATCGCGAAGCTCTCTGACCTGTTTGCGCTGGACGCCAGGGGCGTTCTGTACCGACTCGCGCGTTCCACACGGGACCGACCTCGGG
ACGTACAGGATGAGCCTCGCCTGGTGGTGCCCCAGACTCTGTATGCCGACCTGCTGCACTACGCTCACGAGGATTTCCAAGGTGGACACCAAGGCATCAC
GCGCACACACGAACGACTCCGGACCGAGTTCTATTGGCCCGGTATGTACGCCGACGTCGAACGTTTTGTGAAGGAGTGTGTCGATTGTGCAAGCGGAAAG
GGGCGACCTCCCAATCCTGGACCGTCGCCTGGTAACATCGAGCCTCGGCGTCCACTTGAAGTGGTGTCTATGGATTTCGTGACGCATATGCCCATGTCAG
CACGGGGAAACACTTTCCTGTTGTTGTTCCACTTTCCTGTTGTTGTTACACTTTCCTGTTGTTGTTCCAGATTCATTCTCGGGCTATGTGATGTGTAAAC
CCATGTCGTCTACGACGGCACAGGATGTGGCTGAGGCATACCAAGAGCGAGTCTTTCGGAATTTCGGTGCGTCGTCGATGATCAGACACGATCAGGATCC
TCGCTTCATGAGTGAGGTGTTCACTCGCTTCCGGGAGCTGTTGGATAGCCGTCAACGCGCGACCCTGGCCTATCGCCCTCAGGCGAACGGCCAACAGGAG
CGGTCTGTCCAGACCGCCATTCGGAGCGTCCGCGCCTACATTGCCGAAGCAGACCAATCTGACTGGGATGACCATGCAGAACGACTGATGTTCGCACTGA
ATACCTCCTTCGACGCGACCAGACTGGATACCCCATTCTATCTGGTGCACGGTTGGGACGCACAAGGAACGGTGTCGGCGATGCTAGGGCCGAAACCATC
CAGTGTGCCTGAGCGTACAACATACGAGTGGCGTCGAAAGTTTCAGCGCGACTACAGCTATGCGATCGCATGTGCCGAAGATCTTCAGAAGCAGGCGAAG
CGGACACGATCTGAGGAGCAGACACGAAAGTGGAAAGAACTCTCCGAACGATTGAAGGCCGGATTCGAGAAGGGAGATTCGGTATGACTTTACATCCCCA
AGGTCCAGACAGGATTGAGCCGCAAGTTGGCTCACATGTGGCACGGGCCGTTCAGGATCGACGAGGTTCATGACGACTTCCGCGTGAAGCTCAAGGTTGA
GGACACAGGATACCGCGTCAACCCGTGGGTACACATCAGTCGCCTTAAACCTCGAGCGCTGTTCCCGAAACGATCTACCGTGGAGCTCGAACTGGATGAC
GACGACGATTTCGATGCGGCGTTGTTGCCTGAGGACAGCTGGGAGC