Description :
From Genome Similarity Track
Location :
contig_74:97906- 100900
Transcript NameFunction/comments
g10035.t1hypothetical protein

Sequence
2994 bases(100 bases per row)
AAGTGTCGGAGGGGGAGTGGATTTCCTATTTCCTGCAAGCCCGGGAACCGGAACTGGAAGACTATACGGCAGTGGACCTGGCGATGAAACAACTCAAGAT
GAAGACAACCTTTCCTGATGCCGCATCACGAATGGGTCAGCTGCGGGCTGACATGCACCATATCCTCGACGAACATACCGTGGAGCAGGTGATGCTGGAG
CGGGAACAGAAGAAGGTGGTGAAGTATTTTGTCGCAGCGCTGGAGCCGGCGGAGTTCCGCGAGGCAATCCAGAAGCGTCTGCAATACGCCCAGCACAAAG
CTCTGAAGACAGATATTGTCAAGTGTTACGCGTGGGTATTGGAGCAACTTAAGGCATATTTGGTCTGGCAGCCAGCCCAAGTAAAGCCCCAGGCTCGCCC
GCAGAGCAAGTTTGGTCAACAGCCTCGCCGACCACAGCAGGAGGACAACCACAGCCATGGAGCGAAGCCTGGGCCGTCATCGGGAAACAGTAGCAGAGGT
CCGACAGAGGGAAAGCCACCCCCAAAGCCGCGCAGTGGAAACCCGCCTCGTCGTACCTGTCTCAAGTGCGGATCGCAAACGCATTTGGTGCGGCAGTGCC
CAGATGTAACCCCCGATGAAGTGGATAAACTCCTGGCGGCGCGAAATCCGTCGACCAATAGCGCGACTAGCACTCACTTCAAGCGTGTGCAAGTTGTGAA
TGAGGACAGTGCCGAGACAGGTTGTGCGCAAGCAACTACGTCCAATCACCCCCTGCGTCACTCGATAGGCTTAAGGGATGACGACGGTACGGCTCAAACG
ACTATTGACGGCTTTACTCTGCAGACATCGCTGCTAGATAGTGGTGCGGATGACTCCGTGGTCAGTGGAGGGATTGTGCGCGCTTTGGAGTCGGCTGGTG
TTCCTATCCTGACGTTTTCGGCTAACACGGCATTGGAACCTGTGGGTGGGCATTTGATCCCAGTTGCCCGGAAAGTACGTTTTGGTGAAGTGGAGTTTGC
GACCTCAGCAGGTCCACTACTTCTACGCAACCTGGATTGTTTGGTGCACGAAGAAGATCGATCGTTGGCTCTAACCGTGGGCCGTCCAGTGATGAACCGC
CTAGGTTACTCTACAGACGGTCTGCTCGCTGCAGCACGAACACGCCAGCCCGAGTACTGTCTCACGGAACCAGCAGAGGAGGACTCCGACAAGAACAACT
CGCCGTTAGTCCGCGTACAGGCGATGCGAACTCGGCTCCTTGATGAATTGGACGTGGACGGTGATGATTTGGATGAACTTGTTGCATCTCCAAGGCTCGT
CGCAGAGACCACGCGGGCCGTACAAGAAGCTCTGGAACTTAAAATACAAGAGGCGCGTGCGAATGGACTAACAAGCAAAGAAGGGGACGATTTGCAGGAG
CTCCTGTTTCGCCACATCGACGTGTTCCGACTCTCATTTGGTGATGACCCGCCAGTGCGCGTTCCCCCCTTCGCGTTCATCTGAAGGAAGGAGCTCGGCC
TGTGAAGGCTAAAGCGCGGCGCTATCCGCCTGATCACAAACGGTATTTGGAGGAACACATCGAAGAACTCGTCCGTCACGGTTTAGTGAAGAAAAATCAC
CGCAGTCGCTGGGCGTCAGCACCTCGGATTGTGGCGAAACGGAAACCCGGGGAATACAGGATGACTGTCGACACACGGGCCGTCAACGCTCTCACCGAGC
CGATGCCGTGGCCTATGCCAGACATCGAGGCAGACTTGGCTCAAGTCGAGGACTCTGAAGCGTATTTCACGATTGACTGGTGGCGAGGATATTGGCAACT
TCCACTGGATGAAGACTCACAGGAACTCTACACTATCATGACACACCGCGGGATGTTTACCCCGACCAGAGTGTTGATGGGCAGTACGGATGCGGTAGCA
TACTGCCAAGGCGTCGTCGAGGAGATTTTTGGACCTCTTCGTGGCGGTCAGATCCTCGCCTGGCTCGACGACATTCTCGGATATGCTCGCTCGCCATCCG
CGCTGCTGGTCGTGCTCAAGAATGTACTGGAGTTGTGCGCAGAGTACGGTTTGAAGTTGCACCCTCTAAAGTGTTGTTTCTTCACCCGTGAGGCTACCTG
GTGTGGACGAATGATTTCAGCACAAGGTGTTCGTCACTGCCCATCTCGGATTGATGGGTTGGTAAACTTGCCGGCGCCACACACAGCAGGGGAACTACAG
CAGTTCCTTTGTGCTGTAAATTGGATGCGTGGCAATATCCCCGAGTACAACGCTCTCACAGCAAAGCTGTACGAAGTCCTGGAAGCGGCGGCTACTGTTG
CTCAAAGTCGGAAGAAAACGCGGTTACATCGGGTGCTGCTTGACTCGGTCGGCTGGGGTCCGGAGCATGATACGGCACTGGCCAATGTCAAGGACGCTCT
GCTCAAAATGGTCACATTAGCCCATCCGAAGGACGACTGGGAGGTATGCCTATTTGCTGATGCGAGCCAAACTCATTTCGGAGCAGTGGTGTCGCAGATT
CCACCGGAGGATGCCGGCCTGCCCATCGAGAAGCAGCGTCACCAGCCTCTCGCTTTCTTAAGCGGATCATTCACTGGGGCTATGGCACGCTGGTCTACGA
TCGACAAAGAAGCCTACGCGATTGTTGCGGCATGCAAACGCTTGATGTATTTGCTGCTTCGTCCGCGAGGTTTCCGTATTTTTACCGACCATCGAAATTT
GCAGTATGTGTTCGACCCGCTCGCGGTCAACAGTTCTCTCGGCCGCCATCAAGTCGACCGTTTGCAAAGATGGGCAATGACTCTCACTGCCTTTCGCTAC
GTTATCGAGCATGTACGCGGGGATGAAAATGTGTGGGCTGATCTTTTGTCTCGATGGGGTGCAAGCGCACCGACAAAGGTAGCCTCCGCTCGAATGAGTA
CTTTGCTGGTGGTGAACCGAGTTTCGCCGCTGACAGAGCCGGATTTCGCTTGGCCTAGTGAGCTCGACATCGTGACTGAACAACGTCAGCAGCT