Description :
From Genome Similarity Track
Location :
Scaffold_491:979- 3355
Sequence
2376 bases(100 bases per row)
ACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACATACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCG
CACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTC
CTGTCTTCGCCGTTCGATCGTTGGACGTAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTC
GGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGT
TTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCT
CGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTC
TAGCAGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCT
GGCCACTTGTTCCCTGGTGGATCTGCCCAGCTGCCTATACCAGCTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGAC
GCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGGTCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGG
CTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGG
GTCGAGCTCATCATGGGAGTTGTCTCCATCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTC
ATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAATAGCCTGTGGCCGTCTGGCCCACTG
GCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAGTCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAG
ATGACGCGTAGGGTCTACTGGATCCCGAGCCTTCACGCTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGT
CTTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCAACCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGACCCTCGGCGACGACA
CCGGATCCATAGTGCGCGACCTTCTCTGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATA
TCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTC
TCACCGGTTCCCTTGGATCTTTGATCTGGCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAA
CTCGAGATTCTTGTCTGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTCGTCT
TCTTTCTCGTTTCTTCGACTAGCGGAGTTGGGTTTCGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGACTTCACTTTTCCTTG
TTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCTAGATCCGGTAGG
TCTAGATCAGGATCCACCTCTCTTCTGTCGACAGAGTTACTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTTGATCCGA
CCTCCGACGACGCCTCTTTCCCTGACTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCTGAGTCACCAAAAGATCCGGGCACGCGCAC
CATTGTGGGGTAGCGGGATCAGCAAAATCTGCAAGATTGCTGGATCCAACTTACCAACTGCGCCCAGACACCGACT