Description :
From Genome Similarity Track
Location :
Scaffold_1211:979- 2342
Transcript NameFunction/comments
Phyke_g11647hypothetical protein

Sequence
1363 bases(100 bases per row)
TATCGAGAGCCTTGTTTGCAGCCATGCGATTGCGTCTTGGTGTGCGTATTATTCCAAGTTCGCTAAACAACCGCTCGCACGTCGCCATATTGACCGCAAT
TGATAGCACTTTCATAGCGAGTTTAGGGAGATTGCTTTTGGGGTGCTCTCTCGCAATATATTCCCAGTATTTTCATGCCGACCCGCGAAACTCACTGGAC
TTTGTCCGAGCAAATCGTTCATTTAACCAATCGAACGTATCGGCGCGAACCTCGCTAATATTCTCATCAAGGTACCTGCAATAGTAGTAGACCACTGTCT
TGCAAAGCTTGCCGTAACCTGACACATAAGTCTCAAACAGTAACCAAGCTTCCTTTGCATAAGCCGGATGCAAAGCGATTGCTCACATTGCAGCCAACGT
GCTTCAGCGCACTTAATCAGCTTTTCACGGCGAAGCAGGTCACGACGGATCCCTGGTATATGTCTCGAAACGACAACACTATATCGTCCTCAGTGTTTTG
ATCATGCTGAAGCCGGTAGGATGCATAGGATAGAGGTGCAATGACGCCTTCAGCTCGTTTGAGTTCATCCCAAAAGAATGCTTTATCGAAGACACAGAGT
TGAGCTGAAAGCTCAGGGTCACCCCTTAACTGCCGAGCCAGCATTTGAAGAGTAGACTGCACACGAAGCAGAGATGCAAAACACCCTTGCATCGAGTTCC
ATCGGTTTTCACATAGAGAGCGGAGTCCAAAGTACCTCCTGTAAACCTTCTCCATGAACTTTCTAGCTCGCTTGAGCCACTTAGAAGACGATGCGTTCAA
ACAATTGAcagtggctgcagcttcacagGCCACGTCACGAAACATTGACTTCAATATGGCTTTGACCAGGTTGTTAACGTCATGTGTGAAGCAAAACAGG
AAGGCAATATGCGGCCATCGTAGAGCTAGAATCCGTCGTGCCCTCCAATATTGTCCGGCGTTGTCAGTGATGACTGTGTTGACGTCTCATTGCTCTTTTT
GCATTTATCCCAGAACcttttcaagctgctgggcaGTGGCGATTTCATCATGGCAATCTCCAGCAGATGGTAAAGCATACGTAAACGTCACACCAAAGAG
TGAGAGCTGACAGCCCAGCAAATGTTCTTTAGAAATATTTTGCCACACGTCGGAGAGCAGGTTTACGCGCCCTCCAGTCCTTGCTTACATGGCTCCCAGA
TCGCCTATATCCTTCTTTTTGCAGCGAGCAGCATGCTCAGCTAGAAGACACCCGCCAAGCACTCACCGAGAAGGAAGAATGGAGGTTACTCTTGGACATA
ATAACTCCAATAAACGGTGGGTCACATCTCGTTCGATGAACCGGTCGGCGAGACGATTGTCGG