Description :
From Genome Similarity Track
Location :
Scaffold_343:9787- 11291
Transcript NameFunction/comments
Phymu_g8851hypothetical protein

Sequence
1504 bases(100 bases per row)
CAGAATCAGATTGACAGATAAGTGGCAAAGCATTTGGGAGAGTTGAAGCGTCAGTTCGAAGACGGCTCTTTGTTACCCGATCGACATGGATGAAAGCCAC
TTCGTAATCGACCTGGAGGACGGCAAAACGCTAGACTTTGTGGGTTCTCAATCCGTAAAATATCGGAGTATTGTCTCGGGTACGAGGTTTGAAATTGACA
ACTTTGTGGTATCGCATTAACATTCTTAGTTGTATCACAGGTCGGGAGGGCATCACGATGTCTGTCCTGCTAAAGGGCGAGAATGATGCTCGCATCCTGT
GCCCAATGCTCATTTTCAAGAACAGGAACTCGAGCTATCCTATCCAACACCTACCGGACAAGGTACCTGGTGTGTACTACCGGGGATCTCCTAGTGCGTT
TATCAACGGTCGCTTGATGGCCGAGTGGCTTCAAGAACCTAGATGCTGGGGAACGGGTGGCCCTTTCGCAGCTTCAAGGGTACTCTGGGTGGATAACGCC
AGCGGTCACTGTGGCAATGATGTAGAGGGCACAGCTCGTGAGCTACGGACCAAGGTGAAGTATTTCCCTGCCAACACTACTGACAAAGTGCAACCAGCAG
ACGGCTTTCCTATCCAGCGCATCAAAGAGCACTGGCGTCGCCTTGCGGAGCGACGCAACATGGAGGCCATCCGAAATGGAGACTGGAAGACAggcacgtc
gtcgtcaggaAAGCTCGCAAATCCTGGCAAGAAGTTttttcttgagcttgcgGCTGAGTGCACCCGGCTCGTGAATTTGGAGAAAGACAAGAACGGTGAC
AACTGGGCGAAGAAATCCATGGTTCAGTGCGGTTTAGATGTTCCCCGCGACGGTGTGTGGAAGGTCGAACAACTGAGCAGAGAGCTCAAGGACATTATTG
CAATCTATCCCGATGCATTTGAGGAGGGCTATTGCGAAGGGGCAACGTCTGTAAATTTGTAGGTGGATATTTGTATTGTATAATATATTTGCCTTTGTTT
TACTTTCGTTAAGAAAAGGACTTACAGGGCGGTTCAAGATCCCCAGAAGGGAATCCATCTGTGTTATCACTGCACACGCAGACTCGAACCCGCGACATAG
CGCGTGGCTCGACGCGGCTAAACCACTCCACCAATGCCATCGTTTATTACTAGTGTGCAAAAATTGTATTGATCTTCCTGGAAATAAACCGAATATAGTC
GTGCACCTGATTTACACGTGCACCATAAAAAATCATGCTCGAATTTGTTCATCAAGGGAATACACGGTTATTAGTCGAGGCACGACTAAATAGGGTGAAC
GGTGTACCGCATAGACAACGAAAAGCTTGGGTTGGCGCCCGCCCATGTGTCGGTGCAAGCAAACAGCATCGCAGAGCATCAGGCCATGCTTCGGCGCCGG
CAGTCCCTTCatgaagaagtgcagcagcttcatcgagCAGCGTGTTGCAGCAACGCGAGAGGAGTCAGAAGCGCGAAGCCACGCACTTGTTCACGCCATC
CAAC