Description :
From Genome Similarity Track
Location :
Scaffold_45:97863- 98968
Transcript NameFunction/comments
Phyra_80020AlNc14C90G5653

Sequence
1105 bases(100 bases per row)
GCTCGAAGGGCCAAATCCCTGCCGGCGTGCACAGGCTGTTTCGGCCGTTGCTGACGAGTGGAGAGAGTGCGGGCGCCACATGACAAACTTGCCAGGCAAG
TGCAGCAGTAGCAAAGTGGACAGCCACGAGCGCTCGGATCTTGCGGCCGCCAATACGTACTCCGAGAAAGATGGCTGCGTGGGCCCATCCGCCTCCTTGG
GGCAACACGCATGGAATCAGTCGGTTGCGGCCTCAGCCAATCGCAGTGCGTGGTGGTGCCACTCTGTGCCTTCTTAAGTGCGAAGATGTCGCAGGTCAAA
AAGTTCAAACACTCAAGGTGGTCTTCCGAAGGTCGCGCGAGGGACATGGCGGGGTTCGGGGGAGGATCTCGCGCAAGCCACTCCGAAAAACCACGAGAGC
GACGCGAGGGACCATCACTCTGTATGGGGCGGAATCTCAAGGCGAAGGGGGCCAAGCCCGCGACGCAGAAGCGCCGCAAGAAGTCCGGGCTTGGCGCGGG
CGGCAGCAGCCCGGCGCTGTCGGCCACGTCATCCTCAGGCGGCGCGTCCACGCCGGGCCACCGCGAGTGCGAGCAGTGCGGCAACAACCTACTGCTGGAG
GGCGTGACCAAGGCCTGGCCCGTGGGCAAGAAGAGCGTGGCGTCCACGGGCTGCCAGATCTGCGACTTCGTGGCCTTCCGGCGCTCGCAACGGACCTGTG
TTCAGTGCACGCGCACGGGCTGCGACCACTTCTGCGAGTGGTGCGGCAAGGGCTTCCACGCTAAGTGCGCCAAGCAGTGCGACGAGGACGTGGGCAACCC
GAATGGCTTCTGCTGTCACAAGTGCGAGGCAGAGCAGAGTGAAGGTCACGACACGGACGAGGAGACCAAGGGCGAGGAGGAGGAAGACGTGGGCTCGCGC
TGCGGTAGCTGCCGACTGCCTTTTTCTACCACGGGAAGGGACCACGAGGACGCCAAGGCCGCTACGGGCTTCAAAGTGAACCAGGCGGTGCTGGTGGACA
ACGATGAGGTGCTGTACAACGCGCTGATCACCGATGTGGACGGCAAGGGCGAGCGCATCAAGATCCACTTCACGCGATGGAGCAAATCGTTTGACGACTG
GTACG