Description :
From Genome Similarity Track
Location :
Scaffold_14:978547- 980948
Sequence
2401 bases(100 bases per row)
TCGTCCGTAAATTCATCGACATCTTCCCCGACAAGGTTCCGGCGGCCCTTCCGCCGGATCGCGGAGTCCGACACGAGATAGATCTCGTGCCTGGCGCCAA
GTACTGTGTCACCAGACAGTGGTCGCTTCCCCGCGACCAAGTCGAGGCGATCGATGCCTTTTTCGAAAGTCGCCGGCAAGCCGGCCACGTTCGCGAGAGC
TTGTCACCCCACTCCAGTCCTACGTTCTGTGTGAAGAAAGCGACCGGGGGGTGGAGGATCGTGTACGCCTTCAACAAGCTTAACGACGCCACAATCCCGG
CACAAACGCCGATCCCACGAAAGGACATGATTCTTGACTTCATGTCGGGCAGCACCACGTATAGCGCGATTGATCTGATGGACGGATTCTATCAGATCTT
GATGCGCGAAGACGACGTGCCGCTGACTGCCGTCAGCACGCCCAGTGGAATGCTGTGGGAATGGCTAGTCTGCCGCAGGGGCTAAAGAACGCCCCCGCCA
CCTTTAACCGCATGGTGTCCCACTTGCTGCGTCCATATCGTGACTTCGCGCCCAGTTACTTTGACGACATCTTCATTCATAGTCATGCCGACGCCGGCAT
GACTGACATCGAAGTTCATCTCCAACACCTACGAACGGTGTTCGGAGTGATGCGCGAAAATAAGCTCTACGCCAACCTGAAGAAATGCATCTTCTGCGCC
CCCGAGATTCCAGTCCTCGGGAGCTACGTCAGCAAGGACGGTGTCCGTGCTGACCCCGAGAAAGTGGCAGCCATCTGCGCCTGGCCATCTCCTCAAGACG
CGAAACAGCTCCGACAGTGGCTCGGCCTCGCGACGTATCTCCATCACTACTCGAAGAACTTCGCGGCGACAGTTCGTCCACTGTCTCAACTACTCAAGAC
CGATGCCACTTGGACATGGCGTCCAGAACATCAAGCTGCCTTTGACGCGGTTAAAACGAGCTTATCCACCGCGCCCGTCCTGATGCTGCCTGACCACTCC
AAGCCATTTCACGTGGTATGCGACGCCAGCGACTTTGCCATTGGTTGCGCCTTGATGCAATTCGACGCAGCAGGGCGCGAACGAGTGGTAAGCTACCAGT
CGCGCCAGATGAAACCAGCGGAACGGAATTACCCCGTACACGACAAAGAGCTACTGGCCATGCGCTATGCGCTGCTCAAGTTCCGAGTTTACCTCTTAAG
CGAACGGACCTTCGTCGTGTACACCGACCACGCGTCGTTGCGAACCGCAACGAAGAGTCCGCATCTGTCCCAGCGCATGGCACGCTGGCTCTCCCTTTTC
TCCGAATACAACTTTGTTGTTCACTACAAGCCGGGCAAGACGAACATTCTTGCCGATGCTCTCTCGCGTCGGCCAGATTACGCTCAACTTGGCCGCCACG
CGATTGGGGACGAAGACGACGACGAGTGCGCCGTGTGTTCTGCTGAAGATGTCACTGCGATGGAAGTCGCAGCGACCAGTTCGTTGCGCGACGCGATCTT
GGCCGCGTACGCGTCGGACGCGGCGTGCTCCGAGCTGATCTCGTTCCTACATGATCCGTCGGAGCCAGCGCGGCGCCGACTGTCCCCGCGGGCCCGATCC
CGCGTGAGCCGCTTCCGCTTACACGAAGGTTTGCTGACTTACAGTGTGGACAACGAAGACTCACCACGCATCGTCGTCCCGCTGGACGACGATCTTCGCG
CCCGATTGATTCACGAGTTTCACGATTCTCCCAGTGGTGGCCATCTTGGACGCGAAAAGACCTTCGCGTCCCTCTCTCGCGATTACTACTGGCCGCACAT
GTACAAGTGGGTGCGTAAGTGGGTTCGCTCATGCGAAGCGTGCCAGCGCGTGAAGCCTTCCCCGTCGAAGCAAGCACCGCTTCGACCCCTCCAGGTGGCC
TCGGAGCCGTGGTCCTCCGTCAGTATGGATTTCGCTTTCGGCCTTCCCCGCGACGCCCAAGGTCGCACTGGCATACTCGTCTTCGTCGATCGATTCAGCA
AGATGGTCCATCTTGCTCCAGTCGCCGCTACTGTCACCGCCAAGCAGTCTGCGGCGACGTTTCTGGATCTTGTTTATCGCCATCACGGCTTGCCAACATC
GATCGTTTCCGATCGCGATCCCCGCTTCACCTCAGCTTTCTGGTCAGAGATCTTCCGGCTTGTAGGGACGCGGTTAAAGATGTCCACCGCGTCGCATCCG
GAAACGGACGGCCAGACGGAGCGTGCGAACAGGGTCGTTGAGGACGTGTTGCGGAGCTTCGCCACGTCATTCACGTCCTGGAGCTCGTTCCTTCCCATGG
TCGAGTTCGCTATCAACAATGCGGTTCACGCATCGACGGGGCTCACTCCATTCTACGTGAACTACGGACGCCATCCCGCGTCCCTGCCCTCCTCGGCATG
G