Description :
From Genome Similarity Track
Location :
Scaffold_90:9785- 11383
Transcript NameFunction/comments
Phyke_g3809hypothetical protein PHYSODRAFT_249671

Sequence
1598 bases(100 bases per row)
TTTAATTTGTTATTATTACTTCAAAATGTTCTATCGTTGACTGGACACTATACTACTATTGTTCAAATTTAGCTCACATTCAGCTGCGCTGCAAGGTCCA
AGTGACCGCCTTCAGATGCGTGTGGAATCCATATAAGCAGAGAACCACCTCCTGTGCCCGGGAGGCCCAAAAACCCCGGGCGCCAACGATCTAAGTACAG
CGTCTTGCCGGCTAATGCCTTCACGGTTGACGTCCATTGTGCGGTGCCACCCTTTTTAACATCCACTTCACCGATTTTGGTGCCGCCGGACATGATATTC
ACGGTCACGTCCTTAGTATCTTTgctggtgaagttgatgacGACCGCACCGTCGCCCTTCTTAGTCCAAGACATCGTACTGCCGTTAAAAGCGTCTTGGA
CGATGTTCATTCCTAACGTAGCTTTATCCGTGCCATCATCGATGTCGCCGATAAACTGTGTCGGTCCGCAGATCGTTTGCAGATACTCTGCAAAAAGACC
TGTAAGACCCGTCAAATCGAAACCGGTAACGGCAATCGAGATAAAGACCCTATCGAAAGTCTTGTAAATCATCTCGTTCCTCTTCATGGATGTGGCGTTG
TTGCTTTTTCCCGTTGTGATCAGCTCGTTGATGATGAGCGCGTACGATTTACGAAGGGAGTCACGAGTCTTGTATGCGGTTGCTTCATTAGACTCTGAAA
TCAGTTGATCCATGCAGTTGTTCGTCACCGTAGCAATGTCAGTCGTCACGAGCTGCGACTCGGACATCTTGATTCGCAATTCGTCCTCCGTGATGCTAGG
GTTGTCTTTCCTGTACTGACCAACTGTCAGCCAAGCGCGATCCGTAAGCGCGCGCATGTCATATCCGCACGTTGAGTTGGACTTCAAGGCGTCCTTGAGC
GTAGCGATCTCAGTGTCATTAATGCTCTCAGCTGCCTCCGTAAAGTTGGCGCCCTTCAGAAAGGCCTTGAACCTGTCCCAACCCGACACGATTTGATCGT
CGTACGCGATGATATTGATAAGGATCCACTGGAAAGTAACGAGCACTCGACCGGAGATATCAAGCCACTGTGGCACATCGATACCCTTGCACATGTAGAT
CGCCATCGGCAAGTCCGTCACCACGTTGTTCGACTGGTAGACCATGTCGAGAATTCTAGTGCGCGTTGCTGTCGGGTCCGTGATCTTGACTCCACGGACA
AAACGTATGATGGCTCTGACAACACCAATCATCATTAGACCGCATTCCAAAACTGTTCGGATCCAACGGGCCCCCTTTACAAGCTCCAGTGCaagcgcaa
cagcagcacccgCCATAGCCGTGGAGACGACGGCTGTGGTCTTCCAAAACACTTCCATACCGCAGTCGTCGCTTTGTCGGATGCACTCAAGACCACACTC
AATCGGGTACTCGAGCGGGCACTCCGTCCAACACGTACCTGTCAATTTGTGGCGGTTGAAATTCGAGGGGCACGTCTTCATAATGTGTGCCTCACGGTAG
CATGCGGAGTCTGGTGCCACGGACTGTGGGCCCACCCAGTTGCGGTACGTCGATACAATCGTGCTCTTAGCGTCGATCGGGTTAGCCAATACAAGCCC