Description :
From Genome Similarity Track
Location :
Scaffold_4:97841- 99195
Transcript NameFunction/comments
Phyke_g420hypothetical protein

Sequence
1354 bases(100 bases per row)
ATCGTGGATTTGGAGGAGGTGCAACCGCAGAATActgatgaactgctgcaagtgaTCGAGAAAGGAAACAGTCTTCGTACGACTCACGCGACAGAGGTGA
ATGATGTATCGTCGCGCTCACACTGCATTTGCCAGATCAACCTTCGTGAAAAAGGCACTGGACGAGTGCACGGCAAACTGTCACTCATTGATCTTGCCGG
TAGTGAGCGTGGTGAAGATACCAAAAACCATAACCGGCAGCGGCGACTAGAATCAGCAGAAATCAACCGGAGTCTGCTTGCACTCAAGGAATGCTTCAGG
TGCGTACTCGAAATATACCGCGAATGAGAATTTTATGCCTAGGTGGACATTACCGATTAACTCTGCTGTGATTTTCAACAGAGCGCTGGATAGCGGTGGA
CGCAACACTCACATTCCTTTCCGGGCAAGCAAGCTTACTCAAGTGCTAAAAGACTCGTTTGTCAATGCTAAAGCAAGGTGTGCAATATGATTCTTTTACG
ATGACGGAAAGGTTAGTTGCTAACTATTTCGGCTACGCTTGTTGCACGGTTAGAACGGTGAtgattgcagcagtgtcgCCGTGTGCCTCATCGTCAGACC
ATACGTTGAACACACTTCGTTACGCTGATCGGGTCAAGGAGAAACATGTTTCAGCGGATGCCTTTAATGAGGGGAATGCTGAGTCTGATGCCGTAGACGT
CGATGACGTTCAATTTGAGGAGGGTGGGTACAAGCTTGTGTGAATATTGTTTTGTACTGATCTCTTAAATATGATTCGGTCCTGCCTTGCAACGCTACAG
GTTTTGACGACGATGCTTATCCCTCGCAAGCTGGCGGTGGGCAAACCGAAGACTatgatgaggaggaggaggaacaaCCAGGAGATtatgatgaagaaca
agaagacatgcttgaagacgaagatgataACTATGACAATGATGATCACCACGGCGACAAGGATAAGGTGACTGTCCCATCGAATCGTAGACACACTACC
ACCGACTTAAGTGACGATTTGAGCATTCTTCGTGTTAGCCTTCGTCGTCAGTCGAGTAAGTAGTGTGCTCATGCTACCTTGATGTTTGCTTACAGTATGA
TCTAATAGTGTTCTTTTGTGCGTGAATAGGAAAGAGAAGCGGAGATGACATTCACGAAAACGATTACCCCGAGGAAGCCCGGCAGGGTGTGGTACGCGAG
TACTTCCAGGATTTCGAAGGTCATTCAAGTGCTAACTTAGAATTGACGTGCATTATTTCCATTGATAGGTGCAAACACTTTATGAGGAGCAAGAAACTTT
GCTCAACACGCACATGACGGCAATTCAGGTACACACGAGTTGCCTTAGCCTCTT