Description :
From Genome Similarity Track
Location :
Scaffold_111:97809- 99062
Sequence
1253 bases(100 bases per row)
AAAGTCACGCACCTTGGTTCGGGCTCCTCCCGTCTCATGTCGCTCGAGTGCATTCGGTTGGCCTGTCACGTCACTCGAGTGGATCTGTGCTGCACTGCAG
TGCAGTAGTTCCATGCACTGGCTGGGCTCGTGTGGACCGTGGTCGTGTAAAATCCGTCAACGCGAAGGCAACTTCAAGTTGCGTGATACTAGATAACGTG
GGTGCGGTGACTCACTCGAGGGGTCGCCGAAATCCTTTAAAACGACGCTTACCAGTAGTACGCTCTCGGTGGACTGTACTTGCGCCAACTTGAGACGTGC
TGCAACGGACAAGCATCATCCCAAGCTCTTTGTATCTGAAAGTTGCGGCATACGGACGGTCGGCGGCAGCGAGACGCAGGTTGTCAAGGTCCTGCCATAG
CCAAGGGAATAATATTGGCCACAGCAATCTATAATGTTTTGGACTGCGTTCTATGGCAAGCAAGAAATACTCTACGACGACGAGCACGTCTAGTTCCTAT
TGCACTGCGGCATTATTCTGGTACGCGCGTCAGCTCGAGATCAAAGGCGGCCGCGGGTGCGCGGGACCACGCGTCCAGCTCCTCGACGCGACTTTCCGTT
TTGAGATCAAAGAGCTCCTGGATCCTGGCGTCCGGTGCATCGATGGCCCCGCCCACTTCAACGGTCGCCGAGACAAAAAGCATGTCCTTTTCCGTGACGT
GCAGGTGCACCTTGGCCACCAAAACACGCCACCCCGCCGCGCTCGTAGCCGTAGAGGGTTAGGTGTATGACGCCCGACGGGGCCACATGGCCACGGTAGT
CGACTGCGATCGTCCCCAAGCACGACTCGCCGTCCGGTAAAACCCGAGGCTGCCCAAGCGTCCGTCCAAGACAAAGCTCGATGGGACGCGGTGAACCGCG
GCGTCACGGCACGGATCTAGTAGCATCGAGAGACCGTCGAGTGCTTTCATTTTCTATGCACGTTTCATCGCGTACCAAGAGCGTTGGCGCGTCGAGCCGG
GCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTCACGCGCCA