Description :
From Genome Similarity Track
Location :
Scaffold_2647:978- 2848
Sequence
1870 bases(100 bases per row)
TCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGTAAGGCAACCCTACGGCCAGATC
CACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCTACCCCAT
CCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGG
AAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTATGTCGGTGTCTGGGCGCAGTTCATAAGCTGGATCTGGCAATCTCGCAGATTTTGCTGA
TCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGTG
AAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGACA
GGTGGATCCGGATCCGGATCGAGAAGAAAAACCTCTCTATCCTCCCCAGGCCCTCTCGGGAACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACA
AAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCATCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAA
AGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCGGGATCCAGGTCAAGCTGGTCCGACAAGGATCA
CGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGACGATCCAAGGGAACCG
GTAAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGCGTTCGACGCAG
AGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCGTCACCGGAGAAAGGTCGCGCACTATGGA
TCCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCATCCTCGAACTACAAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACT
TAAGGACCCTCCGGGGCAATAATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAGTCCCTGTGAGCGCGAAGGCTCGGGATCCAGTAGGCCCCACGC
GTGATCTGACATAATCCGGCCACGATCGAGCCAGATCCGACAAGAAGCCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGGT
CTCACCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAG
GGTATGAGAGCGCCCGGGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATGATGAGT
TCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGAT
CTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATC