Description :
From Genome Similarity Track
Location :
Scaffold_2536:978- 2761
Sequence
1783 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGACAAGTTGGATGCTGGT
TCCCACGTTGGATCTTCATAGCCAACCCACTTGACTTTGAATTCGCGTACAGCCCGCTCCGTGCTCGTCGACAGTGGTGTTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCTCAGGCAACAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTATAGTAC
CAACCGAGTGTTCGGTCGACTGTTGAATTTGTTAACAGCCTTGAGTCTCGACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCTGGTAGTTCC
AGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGATGAGCTAATTTCTTTGTCAAGCCCGGTTTGACGCGCTCCATGT
ACAGCCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGATGGGGCTCTTGCAGGATCTTTCATCTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTGTTC
GTTTCCACTTGGTTGAGCTACAGCGGCCTTTTCCAGTCGACTCACACAAAACTGTGTGGGTTTTTTTAGCTCCCTCCGCTCCCTTTTTCTCAAGCCCGAA
AAAATATTTTGGCCCCAAGGGGAGGGGTATCTCTCGGTGTGTTCCAATGTAATTTTGGGGTTGCCCCCCCCCCCGGTGGTTTTAAATATTCTCTGGCCCA
AAACTCGCTTTGAATGAAGTACCACTTGCCTCAAGTCGACGAGCATCCCAACCGTGAAGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGT
ATTGATAGCAAATACTAGCTTCTCCGCGATTTCGTCCCAGTCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGTAACCCATCACCGACTTCACCGAG
CGTTCCTGCTGTCCATTAGCCTGTGGCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTCATGAAGC
GTGGGTCGCGGTCATGCCTTATTAATGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACAT
AGCCTTGGCAATAACGAATCCCGTAAACGATCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAG
ACGATCTGGAAAGGTCGTTCGGCTAGTACGTTGCCAGGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTAGACATGATTTCACA
TGCTTCTCCACGTCAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGT
GACAGTTCTGCAAGACCTCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGGCTCCCCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAG
ATAGTGAAGCACGCCGTTTTCTGATAACACGAACCGGTCAGCGTACTTCCAGGCATCTCGAGCTTCTTTGTAACTCAGCTCTTCTGCTTCGCGCTGAAGT
ACCTTCTTGATGTTAGACCACTTCTGTCCCTCGTCTTGTGCCACCATTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACCGG