Description :
From Genome Similarity Track
Location :
scaffold_5:97790- 103569
Transcript NameFunction/comments
g8115.t1 serine hydrolase (FSH1)-like protein, putative
g8116.t1 elicitin-like protein RAL7B
g8117.t1 hypothetical protein PHYSODRAFT_388694
g8118.t1 hypothetical protein PHYSODRAFT_294930

Sequence
5779 bases(100 bases per row)
ATACTGAACGGCACGTACGAAGCCCGCGGGACAAGTGATCCGATGATCGAGAGTGCCTACGCGTCCAGTGCTCCATTCTACGAATGGTTTGAGAATCAAC
TCGCCGACGGATCCCCGCTGCTCTACAACGACGCTGAGTCGTCTGCCAAGGCGCGTCTGCAAAGTGGGGCTGACCAAGGAGCAGACCACGCGTGGAGTCT
TTCCTACAAGGGCGTTGAGCAGTCAATGATGAGAATTGACGAGGAACTTCGTCGTCACGGTCCGTTTGACGTCGTCATCGGATTCTCCCAGGGTGCTGCG
CTGTTGACGATTTTGACTATGTGGTACTTGCACCATGGCAACGTGCGCTGGTGGAAGCTCGTGATCTGCGTCGGCGGAGTGGATGTGAGTGGCGTCAATG
TGAGGTCGCTGTTCCTGGACAAGCTGGGCAACCGCATGTCTGTGCCGATGCCTTCCATTCACCTAATTGGCAAGACAGACCCGCTTTACCACGAGTCGCA
CCGACTGGCGTTGTCGTGGGCGGACAAAGCGGATCCCAATGACTTTAACAAGTGGATTTACGAGCATGACGGCGGTCACAAGTTTCCGTCGGTATCGAGG
AACCGTGAGTTCTATGCGGAGTTGGGGTGTGCCATCAAGCAGCACTGTGGCAAGGGGGCCAAGACAGCTTCGGCCAGACTTTGAGCTCATTATGATATGG
GGTAGCACTGAACGTGTAGGCTTGCGCTGTACACTGATACGAAAGTACACGAAATGTGTGACGTTTAATACAACTGAGTCTTGCCATCGCATAAGGGAAG
AGGAATGGCGACCGAAGAGAGCGTATACAAAGAAAGCAACCAAGGTAGACCGTGCCAGAACGAACTGTGAGGCAGGTCGGACAATGCAAAATACTCAAAA
TCACATCAAAATGGACCTGCATTCATGAGCTCGATTACTACGAGCTGATTGCCACGACATTATCGTTCCTCGTAGTCGTTGCGTAGCAAGCCAATCGCTT
AAGCCGAGAGGTTGAGAGCTGTGCAGTTGGGCTGGAAACTCTCCGCCAGCTCCAGGACGTTGATCGAGACCGTTCCGAAGTTAATCACGCAGTCCGCCGG
ACCGAGGGCCAGGAGGTCAGCAATGAGTGAGTAGCAGTCCGCCGTCAGGCACATGAGCAGCACCTGGGCATCGGTGGGGTATGCCGTGGGCGGCACGAAC
GAGTAGCCTGACGCGGTCTGGCATGAGTCAAGGTATGGGTCCGCGGCGAGCTCCAGAAGCTTGGCAATCTCCGACGAGGGGCACACAGTAGTTTCGTCGT
AGGCGATGGTCTGCGTGGCAAAGCAAGTGACAGCGGCGGTGGCGGCGTAGGCGTAGGCGAAGGTCTTCATGGTCTTGGAAGGGGTGGAGGATGGCGAAGC
TGGTGTTGGAGCTTGGAGGAAGATTGGATAATGAGCTCCTGCCAGAGCCTCGAAACGGAGGTTGGTGCTCTAAGGCAGCATCGAAGGTGGGGGCCTCATC
TACCAGCTAAGTTGCATGGCGATAACGATGGCAAGCACTAGGGACACGTGCTGCGGCGGGCGCCGCTTCAACAAGGATGGTGTTCAGGAGAGGCGACTCA
CACGAAAGTGCGGCGTGGTTTTCCAACCAAGTCTCTTGACAACTGTGGCACAGCGTAAAGCTCGGGGCGAGCTTGCTGATCATGCAGATGCGGGCAGCTT
CAACTTGAGACCGTCCGTAACTGAGACCTTGCTTCCGCCGTTGCAGGCAGTGCTGACTCAAATTGGCTTGCTAAGCTAACTTACGTTCGAGATGAGCAAG
CGATCTCAATATGATTGCCGCAGTACGACCCCAGGCCATCTATCCTACCCAATTCACAGCCAAATCCTCGCCGACATCCCCGTGACCTGCAGCATTTCCG
GCGCTATCTTTGAGTCAGCGGAGCCCCCCCCCCCCCCCCCCACCCGACTGATCGTCCCGCCTCAAGTCCACACTGCCGTGATCAATCCGCAAGTACCCCG
GCAAGGATATGTGTCGACTCGACCTTGACACTGTCGACCGCAACTGGAAGCAGCATTGTTCGTTTTCACGTCGACACCATCCGTGCTGGTGTTCGACTGT
CGTGCGGGAAAAGCTGTTCGCGTTGAAGTGCAAGGAAGCTGTTGAAGTTGGATTGTGTAGAGTTTGTGTATCAGAATACTCCACCTAATTGCGAATAACA
AAAATCTAATTGCTCTGCTGAGTATGCGTCACTTGCTGCTGTTCATGGGCCTGCCTTGCTCGACTGCACTTCACGTTGCCCCCTCCGTCATTGAAGTGCA
TAAAGTTCAACAGCCACTACCTCCTCCAACAATTTCTGGTCCTCCTGCGTCGACGTCTCAGTCTCCATGCGACTTCGCACACCTACACCCTCGACGATAT
GCCGCTTACCACCTTCCACCGCCAACGGACCAGTTCCCAGCGAGCATCACCATCGACGGAGTTTTGGGCGATAAAGTGTGGGCCGAGGTGCCTTGGAGCG
AGTCTTTCCAGGACATTCGAGGCCCAACGTTCTGGTCGCAGCCGTGGTTCACGACCAAGTTCAAGCTCCGTTACGACCAGCAGTTTCTCTACATTGGCGC
CTACTTGGAGGAGACCGAGGTGTGGGCCAATGTGTCAAAGCGCAACGATGTGGTTTTCCACGACAACGACTTCGAAGTGTTCGTGGATGCGGACGGGAGC
ACGCACAACTACAAAGAGTTCGAGCTAAACGCCCGAAACACGACCTGGAACCTCTGGCTCAACCGTCCGTACAGGGATGGCGGCCACGAGAACAGCACGC
GAGTGGATCCACAACACGGGTTCGACATGCTGGACAGTGGCATGCAGGCTGCAGTGTTCGTCAAAGGCCGCATCAACGACCCATGTGCGTAGTGTGCAGT
TTGAGACGCTCATGTCTGACATCGGGTAGCTCATGATCATGTTGATGTCACATTCTAGCCGAGCGTCTGCACTACTGGACTGTTGAAATTGCGTTGCCAT
TGGCACAACTTGCACTGCATTCGAAGGCACCAGTCCCCCCCGTCGAAAACTCATTCTGGCGCATCAACTTTTCTCGTGTCGAGTGGTCTGTTCGCGTCGT
CACTGACGGCCTCACGGGGGGACAGCACTACGAAAAGAAGCCCGGCTTGAGTGAAGAAAACTGGGTGTGGAGCTCACAATATGCAGTGGATATGCACCGC
CCAGAGTGGTGGGGGTATCTTCAGTTCCGCCCGCAAGGCGAAAGTCCACCTGCGTTTGCTGAAGCGGTTGTGCCGCCTGATCCTGAGTGGGGTGTTCGGT
ATGTAAGCTTTCAGTATTACTACGCGCAGCAAGCCTTTCATAACGCAACGGGGAGGTACACTCCTAGTCTGGAGCAACTACTTCCGTACTTCACTTCTCG
TGAGGCCATTCAGTGCACCAAGCTACTCGATGTCAGTACCACAAGTGAGTCGTTCAGTGCACAAATCGGGTTGAGAGAACACGCACTCGGCTCCGACGTT
ACCTCGGCATTGGTTGCAAGCATCGAAAACGATGGATATATTTCGGTGGAGAACATGAGCTACACATCAGCCATTGCTGTGGCCGAGTAAGGCCAACCAA
CACCTGCAAGACGATAGAAGACTTAACTGAAAATGACTGATATTTGAGTTTTTTACATGGCAGCTTCGCTGAAGCAACCCCACATACGTACAATCTCTCT
CGCTTCTCGTCTTCGTTACGCAAAATGCTTACGCGAAGTAGATCCACATGCTGAATGTGACGGCCAGAGCAGCGATGGCACTTCCAGCAACGAGAGCGTT
GACCCACATAGGTTTGGTGAGCTCCGTGGCATCGAGCTTCAGGACCTTGTCCCAATGAATCATATACTTGCGGATTTCATCCGAGGGACGGCTCTTGTTC
TGAGTCAACAGACTCACCACGACGCATACGACCCCGGCAGTGACCCACAACAGCAGCGCAAAGTGCTGGAAGTTCATGTAGAAGAACGTATTCCAGATTC
CAGGTAGGTCGCCGTCCATGCTGTCGTCCTTGATCGTCACGAAGATAAGGCGCGAAAAACCGAGCAGACCGCCCACGATCATAGCCGAGAACGCTCCGTA
CACGTTTGCCGGCTTCCATGCAACGCCAAGCACGAGCACAATACCGATAGGAGGCGTCAGGTAGCTCTGGATTTCAACGATCTGCTCGTAGAGACCCGTT
CCGTTGCGCATGATAGGGATCCAGCAGAAACTCAGGACGGCAAAGATGAGGATGCTCATGCGACCGACCCACACGAGCTGCTTGTGCGAAGCGTCCGGGC
GGAACTTGAGGTAGATGTCGTTGGTGACGACCGACGAACCAGCAGCAAACACGGACGCCAAGCTCGACATCATAGCCGTGATGATACTGGAGATCATGAG
GCCAATAATGCCATGAGGCATCATTTCGGTGAGCAGGGTCGGGTACGCAGCGTCGGTGCCGTCCTCAATCTTGCTGAAGTCGAAGTAAATGCTGGCAATG
ATACCCGGGATAACAATGAGGAACGGAGGGAGCACCTTGAGCATACTGGCGAACGAGCAACCAGCCTTAGCGTTGGCCGTGTCCTTCGCCGACAACACAC
GCTGCACAAGATCCTGATCCATGCACCAGTACCAGATTGAGCCTAAAGGCTGGCCGAAGATCATACCCGTCCACGGGTAGTCGGGGTCGTCCGTGGGCTT
CCAGAGGTGAAACCACCCTGAGCGGTCCTGGTTGTCCAGGTTCTCGCGGATGCCCTCAAAGCCACCGATTTGGTTCACCGAGTACGCGAACACAACGAGG
CCACCCAAAGTAAAGACACACATCTGGAACAGATCCGTGTACATCACTGCTCGAAGACCACCGGCAATGCTGTACATGGCACTGAGGGTAATGCAGACAC
CGGCACCGAGATACAGGTTCCAGCCCAACGTGGCCTGGAAAACGATAGCACCACCATAGATACTGGCACTCATTTTCGTCAACACGTACATGATGATCGT
GATGAGCGACAAGTAGTGACGGCACGGAGCACCAAAGCGGTACTCGAGATATTCCGGCGTCGTATACACACCGCAGCGGCGGTAAATGGGGGAGAAGATC
CAGCCCAAGCACAGGATCAAAATGGCAGCGTACCACTCGTACATGGCGACAGCAATGCCGCGGCGAGCACCATCACCGGCCATACCAATGAAGTGCTCGG
CGCCAATGTTACTGGCGAACAACGCACCACCGACGAAGTACCATTGCATGCCGCGGTCGGCCAGGAAAAAGTTGGACACCTCGTTCATTTGGTGCTCTGG
CCCGTCACGAGCAATGAGAGAGGCCGACGGACGCTGAGATGAGATTGCTGAGCCACGTTCGTCTCCTGCGGGGAGCTTCTTGCCCGGGGTGGGCTCCGAA
GCCAGGTAGCCGTCGCCGGGTGACTCGAGCACTTGGTCGTTGTTGCGTTTGGATCGTTTAATACAGGGAAAATACTTGGCCAAGTGACTCTCGCCTGCTT
GGATGGAGGCGATGACGGCCACGACCATCGTGAAGAACAGCACCGTCACAATGATGACGACGTCCCAAGCGTTAACTTTGGCGCCCCCGGAAGTGTCGGG
CACCGTCTGCGTGTACAGCTCGACCATGGCAAGGACTTGAACTCGACGAAGGTAGACTTGACTTGATACAGGGACCAAGAACGGAGGAGAGTCGCTCGCT
CTCCAGGCGGTGAATTGGATAATGAACTGAACTCGGCGACGGTGGCGACAACAACGGTGGTGTCCATGGATGGCACCAC