Description :
From Genome Similarity Track
Location :
Scaffold_126:9778- 11582
Sequence
1804 bases(100 bases per row)
TACGTTGAACTTGAGCGCTCGACGGATAGCCAAGTACCGGTTTCGGTACATTGGGGCTCGCAATAGGTTGCTCCAGATCAGACGAGGTGGCACGGCATTT
TCGTCTATATTTTTTCATCTCTGTTGTAACTTTAGGCTGAGGAGGCACCACACAACTGACGTCGCCACGAAAACGAGGTGCATCGATGCGGAGAGTAAGC
CACTTTAACTCCATTGAACAATGACACTTTCCAGCGCGTTTGACATTTCATTCGCCCTGTGTTGCTTTCGCAAGTCTCAGTCCTGCTGTACAGCTGTCTC
TCTTTCATTTCGTAATCCCCAGGGCAGAGAATACAAAGCCGCAGCCTCTTATCACACACCGCTGAACAGCAGAGAGTTTCCCAACGGAACTTCACGTAGT
CGGCATTCTTTCAGCTTCAGCCAGGTGTGGGGTGGAGGCATAGTGTTTTTGTAGACGGCAAGTGGGGTTATAATGCTGTGAGATCGGTATAACGTTGGGG
GTCCGCCGACGAATGCCTGGAGCAGACAGACAGGCGCAAACAACGTATGACGCGCCTGCATCACGAATCTCACGGGAAATCTATTGTGTATGCTATCCGC
CAGTAACCTATACTCTGATGTATCATCTGGTGGCGTCGTGGATAATGTTGTCGATTCGTGTACGCTGGATATTGATGTACCATTAGCTGTCTACTGGCGG
TCAAGACTCAATGCACGTGTAAGAGCCGAGCAACGCAACATCATCAGTCGAATCCGCACACAGAGAGCCCGAGTCGCCGCCTGCATACTTACCACGGTTG
CGCAAACGCTAGTTCCAGCAAGCCCCAATCAAGCATTGCATGTTCTAGATTGCACACCACGAGGGAGCTCTTAGGTAAATGGATAGTACACAGCAAACGG
ATAAGACATGTTAGTTCAATTTCCGATTTACCTCTAAGGTAACAAGCCCAACCTAAGACCTTACACAAGACCTCCAGTTACATCTGGTCGGCGGCACCGC
GTGTCATTCGCCAGCAAGACGTAGCCACAAGCAGCGTATAAACGTGATTTATTTTCCTTTGTCTCTTGTCTTCTGTCCTACTCGTACCTTCTTGACACCT
TGCGCTGACCTTGCTGATTCAAGACTGAGCTCCTACTCACGCATAGCTGGCAGCGCTTGTCTACCAGCCATTAATCCTACTGCAATCCTTACCTGCATGC
TGTAACTTCTCTACTTCTCACCTCGCCTCGTCTCTCATTGCGCCAGCCTCCGATGCGCCAACGGCTGCATCCGGAGCTGATCTGCAACAGAGTGCTACGC
TGGAATAAGGCTGGAGGAGAGGATATTCGAACCCCCTCCTCAGCCCACCCCAAGTTGACAAACGACTGAAAAACCAGGAAGCTAAAATTAAATAGATTAA
CTCCTTTTTGGAATGACCGAACTTAACACACTATACCCGACTTAACCGGAACTGGGAGTGGAGGGGAATCGAAACAACGAATCCCGCAGTGGAAATGATT
GATTTAAAACCAGCCAATTAAAACATTTCATTATGTTCTTAAGACTATGTGTTGTCTGTAGAAGGTGTCGTGTGACGGGGCACACAGAACCTTGCACAGA
GGAAGTGCTAGAGAGCGTAAGCTCTCGGTCAAACGGTTCCCGGTCTAAGGGAACCGACTACGAGGTTTAAAGACTGAATATATTTTGTAGGTGAGTCAAG
CTTGATCCTTACAAACTCTAAGTCAACTATAGTAAAAGCTAAACAAGTGCTAAACAAGTGCCCAATGGTTGGCTCACCGCCAACCGGTACCACGTACCAT
GGGC