Description :
From Genome Similarity Track
Location :
contig_5:97777- 103547
Transcript NameFunction/comments
g1508.t1hypothetical protein
g1509.t1hypothetical protein
g1510.t1hypothetical protein
g1511.t1XP_008897190.1 hypothetical protein PPTG_05399 [Phytophthora parasitica INRA-310

Sequence
5770 bases(100 bases per row)
ATACTGAACGGCACGTACGAAGCCCGCGGGACAAGTGATCCGATGATCGAGAGTGCCTACGCGTCCAGTGCTCCATTCTACGAATGGTTTGAGAATCAAC
TCGCCGACGGATCCCCGCTGCTCTACAACGACGCTGAGTCGTCTGCCAAGGCGCGTCTGCAAAGTGGGGCTGACCAAGGAGCAGACCACGCGTGGAGTCT
TTCCTACAAGGGCGTTGAGCAGTCAATGATGAGAATTGACGAGGAACTTCGTCGTCACGGTCCGTTTGACGTCGTCATCGGATTCTCCCAGGGTGCTGCG
CTGTTGACGATTTTGACTATGTGGTACTTGCACCATGGCAACGTGCGCTGGTGGAAGCTCGTGATCTGCGTCGGCGGAGTGGATGTGAGTGGCGTCAATG
TGAGGTCGCTGTTCCTGGACAAGCTGGGCAACCGCATGTCTGTGCCGATGCCTTCCATTCACCTAATTGGCAAGACAGACCCGCTTTACCACGAGTCGCA
CCGACTGGCGTTGTCGTGGGCGGACAAAGCGGATCCCAATGACTTTAACAAGTGGATTTACGAGCATGACGGCGGTCACAAGTTTCCGTCGGTATCGAGG
AACCGTGAGTTCTATGCGGAGTTGGGGTGTGCCATCAAGCAGCACTGTGGCAAGGGGGCCAAGACAGCTTCGGCCAGACTTTGAGCTCATTATGATATGG
GGTAGCACTGAACGTGTAGGCTTGCGCTGTACACTGATACGAAAGTACACGAAATGTGTGACGTTTAATACAACTGAGTCTTGCCATCGCATAAGGGAAG
AGGAATGGCGACCGAAGAGAGCGTATACAAAGAAAGCAACCAAGGTAGACCGTGCCAGAACGAACTGTGAGGCAGGTCGGACAATGCAAAATACTCAAAA
TCACATCAAAATGGACCTGCATTCATGAGCTCGATTACTACGAGCTGATTGCCACGACATTATCGTTCCTCGTAGTCGTTGCGTAGCAAGCCAATCGCTT
AAGCCGAGAGGTTGAGAGCTGTGCAGTTGGGCTGGAAACTCTCCGCCAGCTCCAGGACGTTGATCGAGACCGTTCCGAAGTTAATCACGCAGTCCGCCGG
ACCGAGGGCCAGGAGGTCAGCAATGAGTGAGTAGCAGTCCGCCGTCAGGCACATGAGCAGCACCTGGGCATCGGTGGGGTATGCCGTGGGCGGCACGAAC
GAGTAGCCTGACGCGGTCTGGCATGAGTCAAGGTATGGGTCCGCGGCGAGCTCCAGAAGCTTGGCAATCTCCGACGAGGGGCACACAGTAGTTTCGTCGT
AGGCGATGGTCTGCGTGGCAAAGCAAGTGACAGCGGCGGTGGCGGCGTAGGCGTAGGCGAAGGTCTTCATGGTCTTGGAAGGGGTGGAGGATGGCGAAGC
TGGTGTTGGAGCTTGGAGGAAGATTGGATAATGAGCTCCTGCCAGAGCCTCGAAACGGAGGTTGGTGCTCTAAGGCAGCATCGAAGGTGGGGGCCTCATC
TACCAGCTAAGTTGCATGGCGATAACGATGGCAAGCACTAGGGACACGTGCTGCGGCGGGCGCCGCTTCAACAAGGATGGTGTTCAGGAGAGGCGACTCA
CACGAAAGTGCGGCGTGGTTTTCCAACCAAGTCTCTTGACAACTGTGGCACAGCGTAAAGCTCGGGGCGAGCTTGCTGATCATGCAGATGCGGGCAGCTT
CAACTTGAGACCGTCCGTAACTGAGACCTTGCTTCCGCCGTTGCAGGCAGTGCTGACTCAAATTGGCTTGCAAAGCTAACTTACGTTCGAGATGAGCAAG
CGATCTCAATATGATTGCCGCAGTACGACCCCAGGCCATCTATCCTACCCAATTCACAGCCAAATCCTCGCCGACATCCCCGTGACCTGCAGCATTTCCG
GCGCTATCTTTGAGTCAGCGGAGCCCCCCCCCCCCACCCGACTGATCGTCCCGCCTCAAGTCCACACTGCCGTGATCAATCCGCAAGTACCCCGGCAAGG
ATATGTGTCGACTCGACCTTGACACTGTCGACCGCAACTGGAAGCAGCATTGTTCGTTTTCACGTCGACACCATCCGTGCTGGTGTTCGACTGTCGTGCG
GGAAAAGCTGTTCGCGTTGAAGTGCAAGGAAGCTGTTGAAGTTGGATTGTGTAGAGTTTGTGTATCAGAATACTCCACCTAATTGCGAATAACAAAAATC
TAATTGCTCTGCTGAGTATGCGTCACTTGCTGCTGTTCATGGGCCTGCCTTGCTCGACTGCACTTCACGTTGCCCCCTCCGTCATTGAAGTGCATAAAGT
TCAACAGCCACTACCTCCTCCAACAATTTCTGGTCCTCCTGCGTCGACGTCTCAGTCTCCATGCGACTTCGCACACCTACACCCTCGACGATATGCCGCT
TACCACCTTCCACCGCCAACGGACCAGTTCCCAGCGAGCATCACCATCGACGGAGTTTTGGGCGATAAAGTGTGGGCCGAGGTGCCTTGGAGCGAGTCTT
TCCAGGACATTCGAGGCCCAACGTTCTGGTCGCAGCCGTGGTTCACGACCAAGTTCAAGCTCCGTTACGACCAGCAGTTTCTCTACATTGGCGCCTACTT
GGAGGAGACCGAGGTGTGGGCCAATGTGTCAAAGCGCAACGATGTGGTTTTCCACGACAACGACTTCGAAGTGTTCGTGGATGCGGACGGGAGCACGCAC
AACTACAAAGAGTTCGAGCTAAACGCCCGAAACACGACCTGGAACCTCTGGCTCAACCGTCCGTACAGGGATGGCGGCCACGAGAACAGCACGCGAGTGG
ATCCACAACACGGGTTCGACATGCTGGACAGTGGCATGCAGGCTGCAGTGTTCGTCAAAGGCCGCATCAACGACCCATGTGCGTAGTGTGCAGTTTGAGA
CGCTCATGTCTGACATCGGGTAGCTCATGATCATGTTGATGTCACATTCTAGCCGAGCGTCTGCACTACTGGACTGTTGAAATTGCGTTGCCATTGGCAC
AACTTGCACTGCATTCGAAGGCACCAGTCCCCCCCGTCGAAAACTCATTCTGGCGCATCAACTTTTCTCGTGTCGAGTGGTCTGTTCGCGTCGTCACTGA
CGGCCTCACGGGGGGACAGCACTACGAAAAGAAGCCCGGCTTGAGTGAAGAAAACTGGGTGTGGAGCTCACAATATGCAGTGGATATGCACCGCCCAGAG
TGGTGGGGGTATCTTCAGTTCCGCCCGCAAGGCGAAAGTCCACCTGCGTTTGCTGAAGCGGTTGTGCCGCCTGATCCTGAGTGGGGTGTTCGGTATGTAA
GCTTTCAGTATTACTACGCGCAGCAAGCCTTTCATAACGCAACGGGGAGGTACACTCCTAGTCTGGAGCAACTACTTCCGTACTTCACTTCTCGTGAGGC
CATTCAGTGCACCAAGCTACTCGATGTCAGTACCACAAGTGAGTCGTTCAGTGCACAAATCGGGTTGAGAGAACACGCACTCGGCTCCGACGTTACCTCG
GCATTGGTTGCAAGCATCGAAAACGATGGATATATTTCGGTGGAGAACATGAGCTACACATCAGCCATTGCTGTGGCCGAGTAAGGCCAACCAACACCTG
CAAGACGATAGAAGACTTAACTGAAAATGACTGATATTTGAGTTTTTTACATGGCAGCTTCGCTGAAGCAACCCCACATACGTACAATCTCTCTCGCTTC
TCGTCTTCGTTACGCAAAATGCTTACGCGAAGTAGATCCACATGCTGAATGTGACGGCCAGAGCAGCGATGGCACTTCCAGCAACGAGAGCGTTGACCCA
CATAGGTTTGGTGAGCTCCGTGGCATCGAGCTTCAGGACCTTGTCCCAATGAATCATATACTTGCGGATTTCATCCGAGGGACGGCTCTTGTTCTGAGTC
AACAGACTCACCACGACGCATACGACCCCGGCAGTGACCCACAACAGCAGCGCAAAGTGCTGGAAGTTCATGTAGAAGAACGTATTCCAGATTCCAGGTA
GGTCGCCGTCCATGCTGTCGTCCTTGATCGTCACGAAGATAAGGCGCGAAAAACCGAGCAGACCGCCCACGATCATAGCCGAGAACGCTCCGTACACGTT
TGCCGGCTTCCATGCAACGCCAAGCACGAGCACAATACCGATAGGAGGCGTCAGGTAGCTCTGGATTTCAACGATCTGCTCGTAGAGACCCGTTCCGTTG
CGCATGATAGGGATCCAGCAGAAACTCAGGACGGCAAAGATGAGGATGCTCATGCGACCGACCCACACGAGCTGCTTGTGCGAAGCGTCCGGGCGGAACT
TGAGGTAGATGTCGTTGGTGACGACCGACGAACCAGCAGCAAACACGGACGCCAAGCTCGACATCATAGCCGTGATGATACTGGAGATCATGAGGCCAAT
AATGCCATGAGGCATCATTTCGGTGAGCAGGGTCGGGTACGCAGCGTCGGTGCCGTCCTCAATCTTGCTGAAGTCGAAGTAAATGCTGGCAATGATACCC
GGGATAACAATGAGGAACGGAGGGAGCACCTTGAGCATACTGGCGAACGAGCAACCAGCCTTAGCGTTGGCCGTGTCCTTCGCCGACAACACACGCTGCA
CAAGATCCTGATCCATGCACCAGTACCAGATCGAGCCTAAAGGCTGGCCGAAGATCATACCCGTCCACGGGTAGTCGGGGTCGTCCGTGGGCTTCCAGAG
GTGAAACCACCCTGAGCGGTCCTGGTTGTCCAGGTTCTCGCGGATGCCCTCAAAGCCACCGATTTGGTTCACCGAGTACGCGAACACAACGAGGCCACCC
AAAGTAAAGACACACATCTGGAACAGATCCGTGTACATCACTGCTCGAAGACCACCGGCAATGCTGTACATGGCACTGAGGGTAATGCAGACACCGGCAC
CGAGATACAGGTTCCAGCCCAACGTGGCCTGGAAAACGATAGCACCACCATAGATACTGGCACTCATTTTCGTCAACACGTACATGATGATCGTGATGAG
CGACAAGTAGTGACGGCACGGAGCACCAAAGCGGTACTCGAGATATTCCGGCGTCGTATACACACCGCAGCGGCGGTAAATGGGGGAGAAGATCCAGCCC
AAGCACAGGATCAAAATGGCAGCGTACCACTCGTACATGGCGACAGCAATGCCGCGGCGAGCACCATCACCGGCCATACCAATGAAGTGCTCGGCGCCAA
TGTTACTGGCGAACAACGCACCACCGACGAAGTACCATTGCATGCCGCGGTCGGCCAGGAAAAAGTTGGACACCTCGTTCATTTGGTGCTCTGGCCCGTC
ACGAGCAATGAGAGAGGCCGACGGACGCTGAGATGAGATTGCTGAGCCACGTTCGTCTCCGGGGGAGCTTCTTGCCCGGGGTGGGCTCCGAAGCCAGGTA
GCCGTCGCCGGGTGACTCGAGCACTTGGTCGTTGTTGCGTTTGGATCGTTTAATACAGGGAAAATACTTGGCCAAGTGACTCTCGCCTGCTTGGATGGAG
GCGATGACGGCCACGACCATCGTGAAGAACAGCACCGTCACAATGATGACGACGTCCCAAGCGTTAACTTTGGCGCCCCCGGAAGTGTCGGGCACCGTCT
GCGTGTACAGCTCGACCATGGCAAGGACTTGAACTCGACGAAGGTAGACTTGACTTGATACAGGGACCAAGAACGGAGGAGAGTCGCTCGCTCTCCAGGC
GGTGAATTGGATAATGAACTGAACTCGGGACGGTGGCGACAACAACGGTGGTGTCCATGGATGGCACCAC