Description :
From Genome Similarity Track
Location :
Scaffold_211:9777- 12461
Transcript NameFunction/comments
Hyaar_Emoy2812647metalloprotease family M01, putative
Hyaar_Emoy2812646membrane alanine aminopeptidase

Sequence
2684 bases(100 bases per row)
GGCAGCATAATGGTGACTCAGGTCGTCACGACTCGGGATGGTCTTTGATTCAACCAACGTCAACGCACGTGCAGAAGGGGTGAGCTCATCTGAGAACAGG
ATCGAACCGTGCAGCTTCACAAATTCGGACGAAATTTCTACCGTCTTGTTTTGCTTCAACAGTCCTTCAATCACCTTCGCCTTCTCGGCATCTGCCACGC
TGCGGTAAGCCTGATACTTGTTTACAGCATCCGGATCGGACAGCGCTTGCTTTGTGAGCCGCGCTACGGACGGATTCGTCTGCTTTGATTTGCCAAAGAA
AGACCACCCACGGGCAAAAGACAGGAAGTCCGGCTCGTCCGTCACATCCGGGATAACAAGTTTAGTGTCTTGCGTGTTCATGAGAAACACGCCTTCTTTC
ATCGACATCCCATCTTTGACGAGTGACCAGTCGATTGGAATTTCCCAAGGACCATTATTCTCAGCAGGCTTGTCTTCAAAACCTGTCTGCGAGATCTCTA
CGACATATTCGCTGGAATCGGCCTTGTACTCCGTTGAGTACGTAACTTCAGGGTGACCCGGACGGTTCAGCCATGTCTTGGCCAGATTTTGCAAGTCAAG
TCCCGAGCATTCTTCCATGCACTTGATCCAGTCCATACTCGTGGCATTGCCAAACGCGTATTTAGTGTGATACATGTCAAGTGCTTTATGGAAAGCATCC
TGGCCCAAAAGAAGCTCCACCATGCGGACGAACTCAGGAGCCTTTGAGTAAGTTACAACAGATACGAGTTCCTGAGTCTGATTGAAACCCTGCGGTTCGA
CAGACAGAGATGTCGCCGACTTGTCTTGAGCAAGAGGTCCAATAGCCGGAGTGAACATGTACAGCACTTCACTCAGGCGACTGTAGTCGTTGCCAAAAAT
AGCCGCTGCACGCTTGCGTTCCATGTGCACTGTGACAGCCTCATTCAGCCAAATCTCGAAAGGTGACTGACCCGTAACCTGGCTGCCGTTGATGTTGTGG
TAGTACTCGTGGACTTTCACATGTTCCATGTACTCATACGACTTGTCGTCCATGCGGCAACTCGGGCACAGACACGAGCTTACAATGGTGGTGTTACCGA
CATTCTCCATACCGCCGTAGTACGAATTCTCCATAGCGATCTCGCGGTACACAGCACCAGAGTACTTGTAGCCAGTCTTCTTCCACACCTTGAGCAGCTC
CTTCAATTCCGCGCGAACCGCAGCCAGACGTGCAGTGTCCGCGTCACTCAGTGGCCTTTTAACATCCTCCTCGTGGGGCCCAAGGCACAGTTCGCCTTCT
TTAGCCTTGATGGCTTCACGCTCTTCTAGCAGGTCGTACATACGTTTGCGCTCGTCATGGTGTTCGCAAGCTTCTGGGCCAAGACTCACCATCACCCACA
GCACAGAGTCGTGCAGCATCTTGACAGCTGCTTTGGCGTCAGCTGCTTCAAAGTAGCCCGGGAACGCCAAGATCTCCAACAACGTCGTGTCTCCGTCCGG
GAACTCAAGTGTCCGTCGGAATGTCTCGTAAGTACCTACACCTAGGAAGAACAAGTACGGTGCCATGTTTACCTTGTGATTATAGTACTTGAGCACATGG
CGCGACAGATCATCGACGTGCAGCACTTCTGCTGCCGGGTGGAACACAGGCACCCCCGTTTCCGTGTGGAATCCAGGTGCCAAGTCTCCGTTCGTAATGA
CGTTCGTATAGCGCTTATTTGCGACAATAGTTGTCGTATAATAAGCTTTGGCATCCATCGTGTCAATACACGGCACAATGCGCTGGAATCCATGCTGCTG
GCACTGCGTGATGATCGTCTTGGGGGCACCCTCCGGAGTATAGTCATAGTATAACCCTTCCAGTATATTCTCAGTTGGAGTGGCCACTGAAACAGTGCGG
ATCACAATCTCGTCTCCAGGCTCCACAGCTTTGGCAAATTTGAGGACGAGAAAATGGTCCTCCTTGTCCACTTCGTACTCCATTTCACGGAGCTCTGCAA
AGCTCTGCACGTGAGCGACAAAGTTCTTTGTACCGCCCAATGGCGCAAACGTCTCGATTTGCTCCACGGACAAAATCTCCAGGTCCTTTGAGTGCAGTTT
CAGCTGCGAGAGCGACTGCGCTCCGTCATGCTTGAGCGTCGTCTGCAGCGTCACCTTCACCTTGGCTTCTGTGATGTCAAACACCATGTCAAAGTGCAGC
GGCTTCGTCATGAGAGGCTGGAAGTCCTCGCGCGTGAAGCGGTACTGCTTGGCGGTCATCATGTTCTTCGTACTTGGCGGTAGATCTCGTAATGGTACAC
GAATCCATATTTGGTGTCAAAGTTGATTGTCAGAGTTTTTGATCGCTTTACACGGGGAAGTTGAGGTTGAGTTTCCCTCTTCTGTTCGCCAACGATTGGT
AGAAACGATCTCGATCAGCGGACACTGATCGCTAAATAACTCTCTTTATTTATGGAGCGTCTCATGTGCGCTCAATTCGGTCGATTTGCTGTTTCTTCAG
TCTTTTTCATCGAAAAACGCTGTCTTGACAGTTACGATGGACCCAGCTAAAGACTGCATTTCGTCTGCGTCTTTTTATCACGCACGAGGAAGGAAGCGCT
TTTACATGATGCATCTTTGTTTCCGTAAAGATGAATCCACGCTTGAAGTCGACTGCCTCATTGAAGCTGCACATGCGTCCCAAG