Description :
From Genome Similarity Track
Location :
Scaffold_90:9777- 11358
Transcript NameFunction/comments
Phyke_g3809hypothetical protein PHYSODRAFT_249671

Sequence
1581 bases(100 bases per row)
TATTCACCTTTAATTTGTTATTATTACTTCAAAATGTTCTATCGTTGACTGGACACTATACTACTATTGTTCAAATTTAGCTCACATTCAGCTGCGCTGC
AAGGTCCAAGTGACCGCCTTCAGATGCGTGTGGAATCCATATAAGCAGAGAACCACCTCCTGTGCCCGGGAGGCCCAAAAACCCCGGGCGCCAACGATCT
AAGTACAGCGTCTTGCCGGCTAATGCCTTCACGGTTGACGTCCATTGTGCGGTGCCACCCTTTTTAACATCCACTTCACCGATTTTGGTGCCGCCGGACA
TGATATTCACGGTCACGTCCTTAGTATCTTTgctggtgaagttgatgacGACCGCACCGTCGCCCTTCTTAGTCCAAGACATCGTACTGCCGTTAAAAGC
GTCTTGGACGATGTTCATTCCTAACGTAGCTTTATCCGTGCCATCATCGATGTCGCCGATAAACTGTGTCGGTCCGCAGATCGTTTGCAGATACTCTGCA
AAAAGACCTGTAAGACCCGTCAAATCGAAACCGGTAACGGCAATCGAGATAAAGACCCTATCGAAAGTCTTGTAAATCATCTCGTTCCTCTTCATGGATG
TGGCGTTGTTGCTTTTTCCCGTTGTGATCAGCTCGTTGATGATGAGCGCGTACGATTTACGAAGGGAGTCACGAGTCTTGTATGCGGTTGCTTCATTAGA
CTCTGAAATCAGTTGATCCATGCAGTTGTTCGTCACCGTAGCAATGTCAGTCGTCACGAGCTGCGACTCGGACATCTTGATTCGCAATTCGTCCTCCGTG
ATGCTAGGGTTGTCTTTCCTGTACTGACCAACTGTCAGCCAAGCGCGATCCGTAAGCGCGCGCATGTCATATCCGCACGTTGAGTTGGACTTCAAGGCGT
CCTTGAGCGTAGCGATCTCAGTGTCATTAATGCTCTCAGCTGCCTCCGTAAAGTTGGCGCCCTTCAGAAAGGCCTTGAACCTGTCCCAACCCGACACGAT
TTGATCGTCGTACGCGATGATATTGATAAGGATCCACTGGAAAGTAACGAGCACTCGACCGGAGATATCAAGCCACTGTGGCACATCGATACCCTTGCAC
ATGTAGATCGCCATCGGCAAGTCCGTCACCACGTTGTTCGACTGGTAGACCATGTCGAGAATTCTAGTGCGCGTTGCTGTCGGGTCCGTGATCTTGACTC
CACGGACAAAACGTATGATGGCTCTGACAACACCAATCATCATTAGACCGCATTCCAAAACTGTTCGGATCCAACGGGCCCCCTTTACAAGCTCCAGTGC
aagcgcaacagcagcacccgCCATAGCCGTGGAGACGACGGCTGTGGTCTTCCAAAACACTTCCATACCGCAGTCGTCGCTTTGTCGGATGCACTCAAGA
CCACACTCAATCGGGTACTCGAGCGGGCACTCCGTCCAACACGTACCTGTCAATTTGTGGCGGTTGAAATTCGAGGGGCACGTCTTCATAATGTGTGCCT
CACGGTAGCATGCGGAGTCTGGTGCCACGGACTGTGGGCCCACCCAGTTGCGGTACGTCGATACAATCGTGCTCTTAGCGT