Description :
From Genome Similarity Track
Location :
Scaffold_162:9775- 16462
Transcript NameFunction/comments
Sapdi_VS20SDRG_16909hypothetical protein
Sapdi_VS20SDRG_16910hypothetical protein
Sapdi_VS20SDRG_16911hypothetical protein
Sapdi_VS20SDRG_16912hypothetical protein
Sapdi_VS20SDRG_16913hypothetical protein

Sequence
6687 bases(100 bases per row)
CACTCGAATGGGTGCTTGCATCACGAAATGGGTGCGCCTTTGTGATGGATATGTGTCAATCACCACTCTGTCGAGGATCAGATGAGTCTGCCGGCAGCTG
CTGGTATCACGCTCGCGTGGTTCCTTGCGTTCGGACCGACGTCCGCGTCTTTTGATTCGAGTGGTAGGTTCGGTGAACCTCGTCCTTCTTCCATTCGCGG
CGGCGGTTCAAGCACACTGGTTCAAGCATGTGGCAACGACGAGAACGTTATGACTCGCTGCATGGACGGTCGTCCCACAGAGTGGTATCGTCTCGTAGCC
GTGGAGTCATCCGATTCCTACACAGTGGGCATTGCGTAGCACAAACTCTGCAACTGCGCGTGCCACCTATGATTCCTCCAGGCACGTTTGCGGACGTTGA
TGCAGCACAGGTGTCAACATTTGCCTCTATCATACCACGGGCGCGGCGCGTCATGGCGCGATCCCAGCGACAGCCTCGCGTTTCGCTGCTTTGCGACGAG
ATCCAGAGGACGATAGGACCGCTATTCCATGCGAATGCTACCGTACGCTCGTAGACGCCATGAAGGCGACGTCACTCAGGAGCAGGTGGCGGAAGCTTCT
TCTGCCGTTGGTGCAGCGACGAGGCTCTCTTTCGAAGCGTGGGACCTGGCTCATAAGGCGGTTTCGACAGAAAGGGCCGATCTTTTATTATTTCGAGGAG
CCAATCCGATCGGCGAGATAAAGACATCTGTCCCACCGGGACCGAGTGGGTTTCGGAGCGCATTTCAGATTTTGGTCCCGATGCGCCAGACGTACCAATT
CGACTCGCTGACCTGGCGGCCGTGCCGCGCACACGCGTGCGGACGGTTCGCCAAGGTCCTCGGTCTTTGCCTTGGCCACGCCGACCACCCGCCATCGTCC
GCCACGATCGCTGCGCTCAAGCAGTCGCCTACGACCAGTGGCGCCACCGACGCGCTGCGCCAGCCCACAGTCACGACGTCCGGACGCATCTGCAGGGCGC
AAATGTGCTCGAAAACCGCAAAGTCGGGCGGCTACTGCATCGCGCATGGCGGCGGGAAGCGGTGCGGCCACACTGCGTGCTCCAAGTCTGCCAAGGAAGG
CGGGTTTTGCATTGCCCACGGAGGCGGAAAGCGCTGTTCCCTTCTCGGATGCTCGAAATCGGCGCTCGCGGGCGGCTATTGCGTCAGCCACGGCGGCGGG
AAGCGCTGCAGTGTCCCTACTTGCACCAAGTCGGCCGTCTCGAGCGGCGTATGCATTGCGCACGGCGGAGGCAAGCGTTGCCAACGCCCTGGCTGCGGCA
AGAGCGCTGTCGGTGGCTTTCTGTGCGTGTCTCATGGAGGCGGTCCGCGCTGTGTCTACGCAGGCTGCAACAAAGGCGCCGTGAGCTGCGGCATGTGCAT
CAAGCACGGTGGCGGCCGGCGACTACCTGCCCGCCCGACGGCTCAGGTGTCGAGCTGAGACGGTGCTGTGCTAACTTATTTTATATAATTCATCACAAAA
CATAAAGAAACCAGCATGAAACGGTTAAAACGCTATTACCAGGGAGCTTATATCTTGGTGGAAGCAACGCTACATATACAGCTATGGAGATGTCGTACCG
CGCGCCGAATCGACAGAGAACGTAGCTCACCTCTTGGACTTGCTAAAGGGTAGGTAGCCGATCACGACAGCGAGACAGTCCCATGCTTCTAGGAGAAGAT
ACGAGACTCGTGGCTGGGGCGAGGTGATCCTGCATGCGCTCCTTCACAAGGTTGGAGGGTCCTTTCCGGATAACAGTGATGGGGCAGTGTGCGTAATCAC
GTTTTTCGAGATTGCCGACAAACCTTCCGTTCGAAGGTTTTGGAAAGGGTCGTGAAATGGGTTTAACGCATGGGTTAAACATCCTTGTTTCGGGCCAAAG
TCCTGAATTCTACGCTGAGATTCGGATGCCACATCCTTTTCGGATAGTGAGTGGCTAATATTCGGACTGTGCATTCTCGATTTTGCGACCAACAAAGCGA
TGACCCGTGGCGACCAACGTGACCGCGACCGCGCGGTACGTCTTCGCCTCACAGCGCTTATGCAATGCAATGGCTCACGTCCTGCGCATCTCTATAGAAA
GCTCAAGCTCGTGCTGCCAAGGCTGGCGGCGCCGGTGGCCGCAAGGACGACTTGACGCCGCTCCAGCGCCGCGAGGCCGACAAGAAGGCGCTCGAGGAGA
AGATTGCCAAGAAGAAGGCGGCGAAAGAAGGTTCCTCGTAGCCCCCACGCGCTGTATAGCCCATATCAACGTGAATGTTGAGTTTACCTTATTACGCGAC
GCGTCCTCTTGGCCATTCATTGTCGCCGTTTCAAAGTAGCCGTGTCTATGGACGACGGTGCTGCCACAACCGTGCAACGCATACCATCCAAAGAGCGTGC
GACGATCGATCGAGACAGTAGATTGCCGACATACCACCAAGTAGCAAGTGGGTCTATCTCTTTGTCGACCAAGTGCTGGCGCCGACTTGAACACAGTCCG
CACTAGTAGGACGAATGCTAAAGCACTGGGTTCGTCTTTGCCAACTTCATGCAGCGCAATACTACGAACGGAATGCACCACGCTACGACGTCGACTGGAT
TCGAAATATTTAGAGTCCACGCTGCAATTAGGTTGTCGCGAGGTTGGGTTTGGACGGCGCGTTGAGCAGTTTGGTGGCCACGGGGGCGTAGATGCCCGAT
AGAATTTGCAGTATCCACTGCGTGTGCACGGTAAGACGTTCGTCTTTGACTTGGATGGCTGCGGGGACAGCGTCGAGCTTGGCTTCGCAGCGCAAGATGG
CGCGGGCTTGGGTTACCGTATCCGACACCCGATCAAAAACGAGCCTACCCCACTCTAGTCGACGGCATGACACAGAGACATATAGGTACCATCCCGAGAG
ACAGAGGAGGCGACGCTGGTCAATCGTGTACAATTCGTCATTCGTGATGCTTTGCAGCACAAGAATGACGCGGTTGTCGCGGATGTAGCGCCGGTAGAGC
ACATGCAGGAGAAGTGGCGTCCCCGGCTCCATGCCGTCCGCGACGACGACTTGTGCATAGCCGAGCTGAACATCGAGCACCTAGCTTGTGCGTGAGCAGT
ACTCGTAGCGCAACGGCGACGTCAGTACCGAGTGGCGAGAGAGCAAGACGCCAGGCAAAATGGTCTTGAAAGTCGGCCACTCGACACTGCTCGCAACGTC
GAGCGGCTGCAGCATCGAGCAGCTCAGCACAAAGTCGATCGCAGCGTCGCCGTAAAAAATCTTGGGGTACTCGCTTTGCGCTGCATCTAAATACGTCTGC
ACGCACGAGAGCGCGGCGTCGGTCTTGTTGCGAAGGTTGGTGAGCACCAAGTCGCAGCTGCTCGAGCGCTGGCTGGGCGACGCGGCCAAGACGACTTGCG
TATACCAGTCGGAGCCCAGTACCTGGTGATAGCACCGGCATGGGAAGACGATGCCAACGACGACGACGTACAGGAATCACGTTGGGGTTGGCCGGCGTCG
AGAAGAGCCGCTGGTACAGCTCCTGCATGCGCTGAAAGTTGAACGACCGGCGGGGATTCGGCGAGCCCTCGGTCGGAGGCTGGCCTCCCGCTTGTGGCCG
CGTTGACGCGCCATTCCCCATGGCCTTCACCACGGGCGCTAAAAATGGACTTTGTCAAAACGCCCTCCATCACGCACCAACCGCAAGCGACTCGGAATGA
CACAAATGTTGTACCGCAATAATGCACCGGAATTACGCTATTTCCCAACCGAACCGTCTCGTGCCCAGAGCATGGAAAGCGTAGCGCGTAGCTGGATATT
CATACATTCATGGGATTCGAATGCGTGTACATGAAAGAGGCTAAACATACTTCTACTATTCATTTACACGTTCAAGTTAAACGACACGCAAGTACGCATT
TCAATTAAGCGGCGCTCTCATTGGGTAAGCGATGCAGCGCCTCGTAGTGGTCTTCGGGCGTCGTGAGGTCGGCGAGTGGCATGCGCGAGAGGTCAGGCAT
CGACTGCGACGCCAAGAGGCCGACCCACGTCATGATGGTGAAGGGCCACGTGAGCACCGGGAGCGCCAAAATCGTAAACACCGAGCTCGTCGCGCAGTTG
AAGAGGAACGTTGCGCCGACGCAGGCCGTCACCAGCACGAGCGTTCGCCAATGGCGCGGCGCAAGGAAGAAGCCAGAGAGCGCGATCGCATTCAGTACGG
GGTTGTAGCCGTGCAAGCCGAGGAGAAGCCCCGCGCTCGGTGCCTGCATGGCGACGGCGAGTAGCGTCACGGCCGTTGACGCGAGGAGCGCAGCGACTGC
GCTCATGGGCGAGCAAAGGAAAATACCTAGCAGCATGACGACACCCGGGAACCAGTCGCCGACGAGGAAGGTCTCGGCAATCCCAGAGAAAACGGCTTGG
GCGATCGCAGCCGAGTCGTAGGACGCAGTCGAGAGCGTCGAGTTGAGCACGAGGCGGGGTGCTGGAAACGCCATGGTTTGAAGACTCGGGTAGAGCTGCG
TCGAGAGCGCGTAGATCCAGATCGACACTTGAAAGGGAAACGTGAGGGTTGGAAGGCCGGGCGGCAGTGCCGAAGCCGTCGCCGTCGCCAAGAGCACGCT
GAGAATTGATAGGAGTACAATGACGAGGCTCGCTACGCCGTACGCATCACCCGTGAAGAACGTGTGCACCGCACACCCGACCAGCGTCGCGTTGTACCCG
TGGAGACCGGCGGCGCGCAAATTTCGGTCCAGGCCCATGAGGCACGAGAAGGCTGTCGCTGACACAACGCCGAGCAGTGCAAAGGCAACCATGCGCAGCC
CTTGGGTCGACAGGCCGAGCGCGACGAGGAAGAGAAGCCCCGAGAGCGGTGAGTTTTGAAAGTTGCATTGACCGACACCGCGAAGACACGTATCGAGAAA
CGCCAGCGCTTGGTGCTTCTCGGTGTAGACGGCCAGTTGTGGCAGCGTTCGAAAGCATGCGACGCTGCCAAGGAGGGGCAAGGTGCGTCGGACACGCGGT
GCGAGAGTCGTTGCAGCGGGGCCTTTGTTCGCGGGCGCCACCTTGGGCGACTCCATTGCGCACCACGGGTCCATGTCGATGGATGGTAGGGCGGGGGTGA
AATGAGGAATAATGGCTGGCCCGTCGCGTGAAGCCATCTTCCTAGTTGTTGAAGTTTGGGATGCAACGGTGGAAACAGCTGGAGGAGTCCAACATGGCGA
GTCGCATAAGATCGCCCAGCCTCACGAGTACTAATATCGACCGAGAAGACTGTTGCAGGAACGCTTATAGAAGGTTTAGAAGCGTCACCGTTGTGCCACG
TACTTGAAGCAGCAACACTGCACCTGCTGGATCCTGCGGCGAGGCATCGGGATCGTCGCTGTTGTTCGGCAGCAAAGTGCAACCTCGGTACAGGTCCATG
TACTAAGAGCGCATGCCTGACGATGGGGAGCATGGTTGTACGATCAGGGGCGTTAGAGTGCTTCGGGTCGGCTCTTGCACGGCTAGACTGTTTCGTCGCT
GCTCCACCTCGCTTGTGTCGAGTTGCTGTTTTTGCTCGAAGGCACGGGTACCGTGTACTCTACATCTCGAGGCACCCAGCCACGGAAGATCTAGAATTTT
TGCCCCGCTTTTGACTGGCTCGGGGTTGCAATCCGCACCCACCGAGACCCGCGAGACACCCCACGTTTCCGGCGCTGGGCCATTACATATGGCTCTGATT
TGCGGGCCAACATTGCGCTGCAATCACATAGTGTTTGGCGGTGAGGCCTTCTGGACGTTGAAACGGTACCCACGGGCAGCTCGTTCACCCACAAGGCACC
TTGGAGAACCTTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN