Description :
From Genome Similarity Track
Location :
Scaffold_102:9775- 32760
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_102-abinit-gene-0.9Transmembrane protein
Pytar_ATCC12531maker-par_contig_102-snap-gene-0.6Sulfotransferase
Pytar_ATCC12531maker-par_contig_102-snap-gene-0.7Conserved gene of unknown function

Sequence
22985 bases(100 bases per row)
CAGATGGGACATGCTACCGCCCCTGCGGCTATCCGTTCGATGAGAAAGACTGCGGGTTACCACGGCAGCAAACTGTGAGTAGTGTGCGGCTCGCTTCTAA
ATCGCCGCGGGAGATCCACGAGATCGCTTTGACCTTGCCTCGCCCCCGCGTCATGGAAGTCCAGCGCATCGCAACGTATTCGGACCACGTCGACCACGTC
TACAGCATCCAAGTGATTGGCGGGTTCGCGCCAGACATTCAACTGATCGAGTTTGCCTTCAGCAGCGCTTTTAAGGCGCGCTTCACGTCGGCGATGGCGG
TCACGAGTGCGAGCATGTACATCAAGTCTTTTAAGATTGGCGTCTCGGGCAAAAGTACGCAGACGTCGTCGCTCGATGGGTTTGCCTCAGCGCTGGAGGT
CGAGACCGCCGTCAACGCACTGATTCTCGGCCGCTCGAGCACCACCAGTGTCGTCCGCGTCAGTCGTGAGCTGCGGTACGACACTGACTCAGTGCTACGT
TGGCAGGTGACGTTTCTGAGATATGTCGCAGATGATCTCACGTTCCCACTGCTCACGGTCGCTGCCGACACCCCATTCGAGGGCTCGCTGACTGCCAAAC
GCGTTTCAGCTTCGGCCACACCGTCAGGAATGGTCGTGCTTCAATATGGAAAGAGCAATAAGACATCGGTCGCATCATTTCCGCTGCTTGCCACGAAGAG
TGATATTGAAGGGGTGCTGCGCGATATGGACACGGTGTACACAGCAATCTCGTCTCGTCAGATCGTTTCTAATACGCCGCCAGTCTACGGCCTTATTTTT
GCCGTCACGTTCACGAGCGTGGATGGGTACGAGATACTACGAGTTGCACAAAATGGTCTTGTGGCAGCGGTGGCGGCGTTGGCTTCCGACATTCAAGTCG
CCGTCACCGAAGTGCAGGCCCCTGTGCAAATCGGCGGCTTCTTTGTCGTGCAGTACGACAGTCCGTACGTCAACACATCGGTGAACGCGACGGTCAAGCC
AACAGAGACCTCTGCGCTACCGTGGAATGCAACTGCCGAGCTGATGGCAGATGAGTTGGCCCGGCTCCATGGTCTTGGAAACGTTAGCGTTTCCCGCCGA
CAGCTCACGCCCGAAGGCGGCATGGACTGGACGATTGGCTTTCTGAACAATAATGGGAACCTCACGATGCTGCAAGCGACATCCCTCAATATGACGGGCA
AGGGCGTCGGTTTACAGACGACCAATGTGGTGGATGGTGTCTCGCTTGGTGGCACATTCAGCGTCGAAATGGGTGGCACCATCACCAAGACCAACCCTGT
CTCGCAGCGTGTGTACACAGTCGTGCTCGACAAGCTGAACACGACTGGTATCCCATTCAACGTCTCTGCCAAAACGCTGGCGCACAGGCTCGCCTTGCTT
AAGGTCACGGAGTGTGCAAATGTGACTCGCGTCGGGCTCGACTGCGATGCTTTTGGCGTCTGCGAAGGATACACCTGGACAATCAGCTATGTTGACAGCG
CTGGGAATCTGCCGCCCATTCAAGTGTACGGCAACAACGACACACTTCGAGGTGCTGGCGCCGCGATAGCAGCGAGAACCGTAGCGAACGGCACATATCT
GAGCGGCTTCTTCTCACTCGTATTGGAGCTCGTGGATCCAGAGACAGAAATCACCCATACGGGCAAGACTTGGAACCTCCCAGTGAATGTGAGCGCGCCG
GGCATGGACCAAGCGTTGGAAGCGATCCGCTTTGTGCGATCAAATCGCGAGGCGGAATACGATCCTGAGACGAAGCTAAGTCGTGGTATTAAGTTTGACA
AAGGTGTGCGAGTATTCCGGGAAGGACCTTACTTGGACGGTGGGTACACGTGGCGTCTCGAGTGGGCCATTGAAGATTACGTGCGGTTCCAAGACTTACG
GATCACGATTGACACATCGCTGGTCACGCAGCTCATTGAGCCGCTTGTCGTGCCGTCGGAACGGGACGCGTCAGGCACGCCACGCTGCAGTGCGATCCCC
ATGGCTCGCTTCCAGCCCGACAAGACCGATCCGTTCGGACTTCGAGGATTCTGCGTCTACGATTTGGCGAATGTGACCATCCAAGAACGCTATCTTTGCA
ACTATACAGTCGAGAACCCGTGGATCGTGTTCACGCCACGCGACTGGTGCACGCCGCAGCAAGTGCTTCTCACGCCCGTGGACGATTTCATCGATGAGGC
AACGATTCGGAACGGTAACACCACGTACTCCAACGTTACGCACACAGTATTCAGCGACGACCTCATCTACTCGGCGTTGCCGCTCAAGCAGATCCGCGTG
GCAGTTGAAAACGATGACGTTGTCAAAGTGCTGGTCTCGGAATCGCACCTCGACTTGAGTGAAGACGGGTCCGTCGTCGCCTATTATGAGCTGCAGCTGA
CTACTGAGCCACTGTATGACGTCAAGATTGTTGTTCTCCCTTGGCTCGACAGTGCTGATACAAAGTGCTACCGCTTTGGCCACTGCAATGTGACGCTTCC
AGTCGACACATTTGTTTTCACGCCGCGCAACTGGAACGTGCCTCAACGTGTGGTTGTCAAAGCTACCGACGACAACCTGGACGAGTTTGATTTCCACGAC
ACGGGCATCTCCCATGTGTCCTACAGTGACGATTTCAAGTACCACCAGCTTCCAAACATTCCCAAGATTTTCGTGACAGTCGCGGACAACGACAACTCAG
CCTTTCTTGTGAGTAAGGCCACTGTGAACGTCACAGAAGGCGGGGACGAAGATCTATACGACGTTGTGCTGGGCTCGGAGCCGTTTGCAAAAGTCACGGT
CGAGATTCAAAATGTCGGGACCAAGGGGAACTACGCGTCAACTTCCCCCTCGCGGCTGGTCTTCACTTGGCTCAACTGGAACCAACCACAAACCGTACGA
GTCGCCGCGGTAAACGACGACACGCAAGACCCTCTCGACTCATCTAGTGTGATGGTTCACACGCTCACGACAAACGATGTGATCTATGCGAATCTCAAGA
ACCTTGCCAGCGTGCGCGTGTGGATTCGAGACAACGATCTCGCGAACATAGAGCTCTCCAATGCCACCATGGCCGTGCGAGAGCGTACGCGGCCGTACAC
CTACAAAGTACGCCTCACGTCTGAACCTTGGTTTCCAGTCGTGGTCTCACCAAGTGGCGCCAACAATTGCTACGTGCGGCCCGCGACGTCTGAGCGTGTC
TGCAACGCTAGTGTGCTTACAACCGCGATGTACTTCGGTGCCGGCAATTGGAGCCAATGGCAGAACGTGTCGTTTCTGGCGTTTGACGATGCGCTCGAGG
AAACGCCGATCCATGCAGCGACGATCACCCACGCGTCCAGCAGTCGAGACCCGTTGTACGCCATCAGCGATTACGCTACCAAGCGTCTCACGCTATCGAT
TGCCGACAATGACCAGTCGTTCGTCAACATCTCGCTCGCAGTATCCAACACTACAACAAAGTCGCGCCTGCACGTTGCTGAGGGCGGCTTCAACGACTCA
TACACGATCGTATTGAACTCCGAGCCGTATGAGAACGTCGTTGTCACCGTCAAACCGCGCATCGAGCTGCTCGTGAGCGTCGACACGGCGATTGATCCCT
TCGACACCGTGCAGGTGGGCACGGCGCTGTCAAGCGACGCTCGCCTGTCGTCCATTCCTACTGGCAAGATGCTGCTCGTGTTCACACCGCTGGACTGGTT
CAAACCCCGCGTCATCACGGTGTTTGGCATTGACGATCAGATCCCAGAGGACCCAACTCAGTTCTCGGCGATCACGCACCGCGTTGAAAGTGCCGACGCC
AAGTACAACATCTCGAATTCTTCACGAGGCATTGTCGATGTGCCCGTGATCATCAGCGACCGCGAGGCCATTCCGCCACCGCTACCCGTCTCGGCGCTGT
TTGACTCGGCCGGCACCCGCGTGCTGATTGCATTCGACTCACCTGTGTACCACGCCGACACGATGCTCGTCCGTATGGCGTCGTCAGGGTCCTCGTATAC
ACTGAGGTTCTCCAGTTTCGCGTGCTCATTAGTCCTCTCGTCATCACTGGTGGCTCTAGGTACGGGCGCCTCGTGTGCATGGCAATCCGATCTTAAGCAG
CTTGCCGTGACGCTTGGAGTCGGAGCGACAGTCCTTCCCAGTGACGTACTCCTATTGTACGAGTGCGCGTCATTTGTAAAGCAAGTTTGCCAGTCATCAA
ACGTGTTGCGTGCTCGCCATACCAGCCGCGCATACACCCAGGCGACCATCACGATCAGCGTCAATCCTGCTGCGATTCCGCGACCCAAGATCGTGATGAA
CGTCCCTGAGCAAGTCGGTACCTGCGGCACGTGGCGTGTCGACGCATCACTGTCGTCGGGATCTGTGGGCCGTGCATTTAAGGATCTGTGGTGGGTCGTG
CTTCCAAGGACAGCGCTGGTAGCGGCCTCGGTGACCAACGATGTGTGGGTTGAAACGAGCCGATCACTGTACGAGGCACTCAACGCACTCTGTATCAAAT
ACGAGAAATTCGCACCACTGGACAAGGCCGATCTCACTACTCAACTATCTTTGTTCATCACGACCGTCGAGCAGCTTCGGTCGCTTTGCTACGTCCGATC
GGTGGCGACGGCGTCATCCACCACCGGTATGCTGCAAATCCAGCTCAATAGCTCACTGCTGCTTGCGGACACGTCGTACGTCGTGGGGTTATCGCTCACG
AACGCGTTTAATCAACAGTCCACAGGCATCCAATTGGTCAAGGTGGGCAAGCTGCCAAGTCCAGCTGTGTTTGCTGTGGGCGAGAACACGCTGCAGATCT
CACGGGGTGAGTCTACGCAACCCATCGTGCTCCAGGTCGATGCTACACTGAGCTGTCCACTACTGGCGGGTGCCCAACTGTCGTTTCGGTGGTTTGCGAC
CGTCGCGGACACAGAAGTAGGCGGATCACCAGTTGTCGTAAATCTTAACGCGACAAACACTGCTAGAGATCCGCGTCTCTTTCGCGTCCCACGGGCGCAG
CTGCAGGCCGGCAAGACTTACTTGTTTCGTGTCGACGCGTCGGTACCGCAGGCCGCAACTACGAGCGCGTTCTTCACTGTGCGTGTCGTTAGTAGCCCGC
TTGTGGCGCTGGTCACTGGAGGCAATCGTTCAATCGGTGAAAAAGACACGCTCGTACTCAACGGTTCGCAATCTATCGACCCAGATGCGGAGGCTGAACC
GCTCGAGTACACGTGGCAGTGCGAAGACTGGACTAACGAAACCATCGCAGCGAGCTCATTAGTACGCTGCACAAACGCCTCGTCTCCGTCACGCGCAGCA
GTGAGTTTGCCGACAGCGTCGTCTCTCCCCACACTGACCGTCGAGCCGTTCACCCTCGCGCCGGAGCGTACGCTTCGCTTTTCCTTGACGGTCCGCAAGG
CCGGTAAGGCGGTGCGTACCGCATCGGTTCAGACGCTGGTGTGGACGACCGCTGGCAGCGTGCCCGAGGTAACCATCGAAGCATCGGCGACACGGCTCAA
CCCGTCCAGCCGGCTCACGCTCAACGCTGTCGTCAAATCAACTTACCCGTACACAGCCCTCTGGCTTGAAGACCAGGGGGATCTCGGTCTCCCGGACGAA
GGGTCCAATAGCACAAGCCACGACGCGTTCACCATGCCCCTGACAAGTCCAACCAACGCAATCCGGCGGAATGCATTGACGCCCGGTCAGCGGTACGTGC
TGCGCCTGCTCGCGGTCGACATTAACGGCAATAGGGGGTTTGGCGTCATCAGTTTTGAAGTGAACGCGCCGCCGTCACCGGGGCAGTTTCAGATCTCGCC
TCGTGCCGGCGCCGCAATGGTCGATGTCTTCTCGCTCGAGTGTCTGCAGTGGACTGACGACATCCAAGACCTGCCGCTGCGGTACTCCTTTGGCGTGCTA
CCCACTGCGACATTTACAGCCCTCGCTATGAACACGACGCTGATCCGCCAGCGAATGCTCCCTCTCGTGACGGACCAGCTCCTGCCAAGCGCGAGCGTGA
CGATGCTCCCACCCGAAGCTGGAGTCGACAGCGCAGCCATGACAGTCGTGGCGTTCATCACTGATGCAATGGGCAGCGCGTCCATCGCGTTTGATGCCAT
TACTGTACGCATGCCTGAGCAGGCCTCAACCCAGCCCGTGGCGTTTGCGTCGTTACTGCTATCGAACCAGAGCTCTACTGACGGCGCCACCCAAGCCAAG
ACCCTGTTCTCGGTGGCGCTCGTGATTCAGCGAGCCATGGGCGACGCTATTTCCCCAACCGAGTGTCCTGGCGCGGGCTCATCTAATGGTGTCTGTTCGG
GCCACGGCACGTGTGATTTGAAGACGCTCATGTGTGTTTGTGAGGCCACGTTCATGGGTCCTTTGTGCCAGTTCACAGTCCAAGAACTGCGAATGCTTAA
CACTGCGATTCTGTCATCGCTCGCGAGCGGCGCCGTGCAGTCGTCGGAGCCATCGTCGTCTGGCCTTTCGCAGCAAGCGATGGTCGTGAACACACTGATG
CAGTCTTCTTCGGCCGCGTTCGACACGGATGGGCTCGCGCAGGTCACGAGTCTCACGAGTACCATCGCGCAGAATGGGTTTGCGTTGCAGGACCCCGCCG
AGTTCTTTGACTCGACCGCGTCGACGCTGGTGAAATCGCTCTCGACAGTGCTTGCGGTGTCTGAAAGTGCCTCTGCTAGTGATACGGCCACACCAACGCC
AGCATCTCGCAGTCGTCGGCGGCTTGATGGAAACTCGCCTTCAGCAAACGCTAGCACAGCAGTCACCTCGTGTGGTAACGAAACAACGAGTGCACAACAA
TCGTTTCAGCAACTGCTCGCGACACTCCAGTCGCTCGCCGCGATCGCAAGCCAGGATTTATTGCCCGGCGAAGTACCAGCCCAGCTATCGTCGGGAAAGA
TCACAACGACTGCTGGTGCAGGCGGTCGGCTCACTCTCTCAACGCCCTCCACGTTCAGTGTGAACCTCACCCGAGCAGCGATCGCGTGTCTCGTCGCCTC
GGGCGACAGCTCCGACCTCTTTCTCAATGCCTTTGANNNNNNNNNNNNNNNNNAATGCTTACTCGAGGAAGCACGCATGATCTCTAGCGCGACGATCGTG
ACGGCCCACAGCAATGCAGCACTGATCGCAGCACTCGCGGGCAAAACGAATGGTGAGGTTGCTCCCCTTGCGCTTTCGAGTGACAGCTTCTGCGTGAGCC
AGGCTATTGCCAAAGACGCTGCAGCAGGTAAACCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCTTCAGACTCGGCG
CAGTGGAGGCCGCTGGTCACGCTCTCACTACCGCATACGCGGTTCCTCTCGGCGGTTGAACAGCGCAACTTTACGACGGGCTGCAGGTCTTGGAATTCCA
AACGCGGACTATGGGAACGCGACGTCTGCGTCAAGGACGAGACGCAGAGCTCAGTCAATCACACGGTGTGCTATTGCAGTGAGCTTCGTGGTGCGCCCGG
GCTCGAAGTGCTCGTGACACTCGAGGAACGGCTCGACTTTTACGCGCTTTCCCGCGAGCTGTACCGCAATGACGAGCCATCGGTCGTCGGACCAATCGCG
ATGGTCGTGGTAGTTGCACTGCTGCTCGTCGGTGGCAAGTACGGACAGTACTTGGACACGGTGGACAACCAAAGAGACAAGGACAAGACGATCAGCAACC
TTAATCGGTCCAAGTGGACGGAGCTGAAGGCACGCGCGCAGGCGACAATGGACAACGCGGAAGCGGTAGAGGACTTTGCATCGTTCATGGCGAAACGGGA
AGCTCAGCAGCCCACGGCAAAGGCCGAAGCGAGTGTGATTACAGCGGCGACGTCTGCCACCCACCTGATCAGTGGAGGAGCGATCGAATCGGAAGAGCTC
ACGCGTATGGTAGAGGACGGCAGTGCCCACCTCCCGAATGAGACGCGCATATTATTCGGGTCGAGCGAGCGATTGGAAAGACAGTACGGCAGGCTCACGT
GGCTCTTGAGGGTCACCAACGTCGTGCTCGTCATTGTTGGTGTGGTTGCGGCGTTTGTGGGGATCGATTTTTACTTTGTGCTGGGCAACAGCACGGCTGA
GCAGCTCGTGCTGTTTCTCTACGGCAAACCCCTTGGTCTCGTGCTGCTCGCCTTTGGCGGTGGGCTTGGTCTTCTGGGATTATGGGGTGTAGTTCTCGCC
AAAGATCGCGCTGATTCGTCTTCTCGGATCGCTCGATCGGCGTACGCATCACTTTTATCGTTCTGTCTGCTCGGAGAACTTCTATTCGTCTTGCTCGCGG
TCCGATACCTCAACGATCTCGAGCAACTACCACTGGCCGGTCTCGACACGTTGCGGTCCCGTTGGGATGCATTGCTCCCGTCCATCCAGGACGAGATCCA
GACAGCGTACGGCTGCTGCGGCTTCACGTCCATCGCGCAATCCCTAACGGGCTGTCCGGAAGAAGCGCTGGACTCGGAGGCTCCGCGCACATGCGTGAAA
GTCATCGAAGCCCACGCCTATGCTCTATTTGACACCTCATTTGTGTTCTTGGAGATCGCATTCCTCGTCCAAGTTGCCGCTGTGCTGCTCACGCAGACTA
TCCGCTCATGGCGTCATCTCCGCATCAGTCAGTTGATGGATAGCACCACAACCTTCGCTCCGTTGTCTGATCTGGACGTCATGCTGCTGTGCTCGTGTCC
CTCCATTCTGCGGTGTCTGCTCGGTCTCATGGCGGCCACACTCTTTATGGGGATTGATTTGCTCGCTCAGCTCCACATTCTCAGCAACGCGCTGATCGCT
GGGCTTCTCGGTGTCGAAATTGGCGTCGCCCACGCTGTCATCTCCGTCGTATACGCGGCCGTGCTACTACAAGGGTTATTGGCAGTCCGCGGGGGTGACG
CAGCACGGCTCCAATCCTTTGCGGCACTGGCAACGACCTGTTTGTTGATCAGTATTGCATTCTGTGTAGTGGTGGATCGCTTCTACGACCACTGGCTACT
TGACCCCAGCGTTGTCGATGTCGTCCATGCCAAGTACCTGCGACTATCACGGGAGACGCTCGTGCATGTCGAGACTTCGCTCGAGTGCTGTGGATTCGCT
TCCCAAGCAGAGGGCGCTTGCGTGACGGCAACGGAGATACCGACGTGTCGCAATAGGGTACTCACCGCACTCCACCATGAGCTCGGACTATTGAGTCGCC
GCCTTAAAGTCTTCACATGGATCCAGGCTGTCGTGTTGGCCTTCGCAATCGTTGCCAGTGTCCGACTGAAGCGCTATACCCCACGCATCACGCCGCTCGA
CGCGTCCACAATTGTTGCCACAGACCCGCCGTTTGTGCTCGCGTCCTTTACCCACGCGCTGGTCTACCACATCAGCCTGGTCGTCTTGGTCGTCAGTAGC
GTTGTCGCTGGCGTGTTCGGTCTCGTGATCGTCGGCGCTGGTATCGACGTGCTGTACCAGATCAACGTGCTCCATTTTTCGGTCCTGCTGCGCGTCTTTG
ACCGCCACGTGGCAGTCTATTTGCTCGTCGCTGGCACAACCATCTCGCTCTTTGGTCTACTCGGCATCGCCGTCGTCTGGACGCCCCATCATCTTCGCCG
CCGCCGTCGGCTTGCGCTAGTGCTTGTGGGGGTGAGTGCCGCCGTCTTTGTGGCCGCATTTGGGCTCGCCGGTTTTGCGTATCGTTGGGCCCACGTCCCA
TTGAACGACGAGGCGCTCGACGAGAAGCTAGAGTCCCTGTGGCTTGCGACACCACCGAGAACGACGCGCGTGTTTCTACAAAACGTTCTCGCGTGCTGCG
GGTACGACAAGATCGTGCGGGTGAATGGTACGACCGTTTTCACCGGTGCTGGCGAGCGTTCGGCGTGGAGGTTCGACAGCGGCATGGTCGAGGCAGAAGC
GTACGCCGCTACGCCCACGCCTTCCTCGCGCCAACGACGGCAGCTCACTGTTCAGCTTTCGACACCGCGGCGGCTCACGCAGGTTGTGTGCCCGACAGAG
GCGACCGATCCCTGCGCACCGCGGCTCAAGACCTATGCGCAAGGCGTCGCCGCTCGCACGTTTCAACTGGCTGTCACGTTACTCGCGGGCGTGTGTGCGG
TCACCGCCTCGGTCGGCGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGACCCGAGACGTCTTCTCCTTTGTCTCCTCCGCTTTCGT
GGAGCATCGCAATCGCGCGGACGCTCCTTCTCGTGCTCTGTGGCTCGTCGCTGGTTGTCGCGCTCGCATCGTTCTTTCTCGGTCTCGACGTCGCGTCGCA
CTGGTCGTTGTTCAGCTCGGCGGCTCTGCAGCTCGTATTCCCACAGTCGGTGGGCGTGGCATTCTTTCTCTATGCAGCATGCGTCTCGTGTCTCAGTGTC
TACACGTTCCAAGGCGTCCTCCAGTCGACCGTGCACCGCATTTTCCTGCAGTCGCTGGGGCGGAGCTTTCTCATTCTCTGCGGCTGGCTCTGCGTCGGGC
TGAGCGCGTACGCATCCCATTTTGGCGGCGCCGACTGGCAGGGGCATCTCGGCGCGTACCTCAGTCGCCAGTGGGACACACTCGCGTCACTCACGCAGCA
CCGCGTCTCGCTCGAGTTCCAGTGCTGTGGGTTTAATGACCCCGTGGTCGTCAAGGGCAAAGGTCTTGTCTTTGACCGCGCTGCGGCCGGCTTTGTCTGC
TCGCTTGCCGCCGCACGCGGATGTCGCCACGCACTAGAGACCCAGATCGGCGCGTCGCTCGCATGGGTTTTTGCCCTCGTGCTCTCGCTGACGCTCGTCG
AGACTCTCACCCTTCTGTGCAGTCTGAAGCTCCTCAAGCACTTGCAGCGCATCAAGCCTCATGACTGGTTTGTCATCGAGAGTCGCGTGCGGTTCGCGAC
GGGTACGTACAAGAGCCGCGTGCGCAAGGCCCACACGCTGCTCTCCCTCGCCACGCGCTTCGACCGCAAGCTCACGCGCGCGCAGCGTGTCACGAGCGTC
GCGTGCGGAGTACTTACCACGCTCGCCGTGTTTGCGGCGTGGTTTGCCAATCACGGCTGCCACCGCCACGCACTCAGGACCTGTCAGCAGCCGGACGCCT
GGGGGTATCTCGGCATGGGCCTTCTCTATGGTGGGCTCCTCGGCGTTGCCGTGCAACGCCTCGCACTCGCGCTCTTTGAGGCTGTTCGCCACCGCAGCGA
CGACGAGACCAGTGAGGTCGCGGCCACTCGACAGCGCAAAGAAAAGGCGCTACTCTTCCGGGGCCTCTTCCGTTCGCGGCGTGACAAGCCATTCACGGAT
CTCCAGCAAGCAGTGCAGGTTACACCAACCGTCGAGACGCCGTCCCACGCGACCACCGAGGAGCGGTGGTACGCGTGGCTCACGCGGTTCACGGTCTCGC
TCTTCTGCGTTGTCGGCGCGCTGCTCTTTCTCTTTGGCTGCGGACTTGCGACGTACATGACGCTCGCGCTGCTTGGCATCACCAACTCGTTCTACGGCGT
CACGTTTGACCACGGTCCTCGCGAGACGCTTTGCTTTGGCGTGCTGCTCGCGGCCACGGCGCTGCTCGCATGGCTCGCGATTGACCGGAAACAGCGCGTT
GCGACCCGCAGCGTGCGGTGGTTCGTCTGTGTGGCCGTCGCGGCAGTGGCGCTGCTGGCAGCTCTCTGTCTCGGACTGTTCATGGCCAGTCAGATCCTGG
ACGAAGACGCGACCAACTGGACGATCCGCAATACAAACGTCAGTATCCCCAACAAGCTCCGCGCCGCGTGGGCGAGTGACACGTCGGGCTTCTTGCGCAA
CCGCATCCAGCAGCAGCTGCAGTGCTGCGGGCTGCGCGACGCCACCGACGCTCCGCTGCGTCCATGTCCTGATGGAACCGTGGTCACGGTCCAGTACGAG
GCCGTGCGCGTCGATGGCCGGGTGGTTCTCGAGTCGAAAGACGAGCTCCGTGACCGCGCCGGCTGCTACGCGGCTATGCTGGCACAGTTCCACGCTCTGA
TCGACCGCGTCGCGTACGTCGCGGCCGCCGTCGGCGTCGCGCTCGTGCTGCTCGCTGCCAGCGCACTGTTTCTCGCCTACGACATGGCCATCTCCAAGGA
CGCCAAGCTCAAGCTCCGCGTCGTGACGTCCGGAAGTGACGTCCGCGAGTCGTTTGAAAAGGTCGTTGGTGTCAAGATCGCGGCGCCGGCACGCGGCAAG
ATCCTGTCAAAACTGCTGGCCACGAGCCTCGACAATGTTGCCCCGCACGTCGTGAGCGAACTCGCCGCCGAGTCCCTTATCGACACGGGGGCCAACGCGG
CGTCGAAACACGTCACGCTTCCCGACGGCCAAATCGTGGCGTCGTCACTGACGACGAACCGGTGGGACGCGCTGGCTGCGCAAAAGACCCTTGCCCACAG
TGTGCCCTACCCTGCGTGGATTCCTCGGGTCGTGTTTGCCGCGGCAGCTGTGTGGATCGCAGCCATGCTGTACATCATCACTCTCCGTTCGCTTGAGCTG
GGCGTTGCCACGGCCTGGCGCTGCGTCGCTGCGTGGGCCGTCGGCGTCTGTTTTCATCTCTTCGTCGTCGAGCCGCTCGTCGTGTTTCTCCAGATCCTTT
GGTCGACGCTGCGTCAGTGGTGGGACACGACGTTGCTCGCGCGCGTACTGCGCTTTGGCCGCGCGGCGTTCACGCGCATCCATGCCAGCCCGGAAGCACG
GGCCGCGCAGCACTACGCCTCACTGAGCCTGTACGAGCGGATCCGCTTCAACGCGGCTGTGCGCATTCAGCGACGGCTCGCCACGCGGCTGGCGCGACGC
CGCTTCTTGGAGAACGCACGCGACCGCCGCGAGGTCTCCCACCGCCGGCTCGTCGCACATCGCCGCCACGTGGTCACGCAGGCCATTGAGGGCTTCACAA
AGCAAGAGATCGATGCATTTCGCGTGCTCTTTGACGACGCCGACACGGCGCGGCTTGGGCTCGTCTCGTACCAGGTCATCGCGCAGTCGATCTACCAACT
GGGCGTTCGAGTGGACGCCGCGCGCGTGCGCGCGTTCCTTCACGAATTTGATCCTGCGTACGCCGATCTCGTCGACTTTGAGCACTTTCTCTACGGCATG
CACCGCGTGCGCGTGCTCCACCAAGAGGACCAGGCAGCTGCGACGGAGGAAACACAGGAGTGCGTCTCGAAGGAAGAATTCGTGAGCTCGTCGTCGCGGT
TTGGCCCGACGGCCGATCCGCAGGCACGCGTGGTGGTCAAGCGACAGAACCTCCTGCGCGAGCTGCGTGAAAAGCGTGAGTCGCTGTCGTACCGACTGCT
GGGCAAAGTCAACAAGCTGCCGCCGCTGCTGCAGCGCGGACACTCTGCGACGAGGCCGGCGACGGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTA
CGGAAGGAGAAGGAGGAGACACCACGATGCCCACGGGTGCGTTTGCGGTGCTGCAGAACCGCAAGCTCTCGCCCAAGAAGCGCGCACTCGAGATGGTCGT
CAAGAAGAAGAGCCGCGATGACAAGGACAGGGACAAGACGTCGACGTCGCCACGGAAGTTGGTGGTGCCAAGTCTACGACTGCCCGGGTCGCCGCGCAAG
GGAAGGAGCAGCGGCCACGCGAAAGAAGAGGAAGGAGAAGAGACGGAGAAGTCGGGAGTCGGGGAGATCCACTCGATCGCCGAGGGTGACGAGGCGGCGC
CACCGTCGCCGCAGAAGACCACTGTGGATGAAGAGGCCAAGCCGTTTGGAACGTTCATGCTGCTAGCCAAGAACACGACGAGCGCGGGAAAGCACAGAGT
CCTTGAGAAGCTTCGCCACAAGCATAGCGACGCACATGACGAGGTGGCGGCAGTAGCGGATGATGACAGCGACGCCGACAGCGACGCGGATGAAGGGGCT
GCTGTTGCCGCGGCGGCGGGACCCACAGGTGACAACACGCGGTCACCACAGACTGCCGGGACCAAGAGCGCACGGCCTGCTCCGAGCGTCGCCGCCAGCA
GTCTCCAGAAGGCGCTCAAGAAGAAGGCCGCGGCGACGGCACCCAAGCGTTGATCTCATCGCCAGCACGTTGCTTTTGTACCGTATGTAGCAGATTCATA
TATAGTATGCTCCATATCTTACATAATCCATTTGACCATCATTCTGCCGCGCATCATGGCCACGCGACCAGCAGCTCCTCCATTCGTCTTATTCGCTCGG
GATGCGCTTCCCGTGGAACGCGCCGCAGCCGGCGCCGGCGCCGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTGGCCGACGACGTCGACATCTCGGCGCTGCGCGACCACATC
CTGTCGCTCCCCGAGTCGCACTGGCACGAGGCGTACCAGCAGCAGCACAACGTGCACTTTCAGCGGCCCTTCCACGACAAGCTCGGCGTCAACAGCATCA
TGTGCCTCTTCTCCGACACGCCGCTGGAAACCGTCTTGGAGCTGCCCTTCTACGCCGTCTACCGCCCGTATCTCGAGCCGCTCTTCGCGCGCATCGGCAT
TACCCCGTCCCAAGTCGTGCGCTGTCTCTTTGCGCGTCTGCCAGGAGCTACGCTGATCCCGCCGCACCACGACAATGGCGTCTGGGTGAGCAAGACGCAC
CGTGTCCACGTGCCGATCGAGACGTTCGCCGACGTCGAGTTCCACAGCGGACCGCTCGAGTCGTCCATGAAGCGGTACGCCTTCAACGAGCGCACGATCG
TCGAGCTCAACAACGCCGCTAAGCACAGCGTCTGGAACCCAGGCGCGCGCTACCGCATCCACCTCATTTTCGACTACGTCGAAGACACCGCGCTGCTGGC
CAAGCTCACGCGCCACGTGCTCACGCCCGGGCAGGTCTGCCGCCAAGTGCGCGGCCGCGTCGAGCTCTTTGCGAGCGACGCTGCCAGCGACAGTACCGAC
AAGAAGCAGGCCGCCAAGCTCCACGCGCAGGTGGACAAGCTGCTGCGCGATCGCGTGGGCAGCGACGCGGCGGCGCAGGTCGTGACGGCGTGCCGCCACT
ACTTTATCGAGCAGATCAGCGCCAAGGACTTTGTCAAGACCGTGGAACGCGTGCTGCGCGGTCACGCCGATGAGCAGGCGCTCAGCGAACAGCTCTGGCC
GACACTCGTGCAAATGTTTGCACTGGTCGACGCGTATGCCAAGCGGGAGCTACTCGCGGCCTTGCGGCGAGACGTGTTTGCGCCGCACTGGGTCATTATT
GGCGCGCAAAAATGCGGCACGACATCGCTCTATGAGCTGCTGAGCCAGCACCCGCAGCTGCNNNNNNNNNNCTTGGCGCGCAAAAGTGCGGCACGACGTC
GCTCTATGAGCTACTGAGCCAGCACCCGCAGCTGCTGCGAGGCAAGCGCCGCGAGCCCCATTTTTTCGACTGGAGTTGGCATGCCGCGCTTCAGTTCACG
CTGCCCGCCAAGGACGACGCGCTCTACAAGAAGATTCTCAAGAGCTACGCGGCCGCACGGCGAAGCAGTCGCCACCCAGAGGACGTGGAGACGGAGGACG
AGGAAGAAAACGCCATCGAGAAGCGCAACGACCTCGAGGGGAACTCGCTCGACGACATGCGGTACGTGACTGCACGTAGGATCTAGCGCCATTCCCGATA
CTAACTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCGGCGAGTCGACGCCCAGCTACCTTCTCTACGGCGAGCGCGTCGCGTCTCGGCTCCACCTGCTCTACCCGCACATGA
AGCTCATCGTGATGCTGCGCAACCCTGTGAAGCGCGCCTTCTCGCAGTTCCAAATGACGGCCGACGCCAGTGGCACGCCCGCGCAGCTCGCAATGCGCGC
GCCCGTGCGCGGCAAGTCGTTCGAGCAGGTCGTGGACGAAGACCTCGCGCTGCTGGCGCAGGCGGGCGTGACACCGGACCGCTCGCCGCTGGACGGCGTC
TCGCACCACGCAGCCGACTGCTTCCAGCAGTACGCCGACGCGCTGCCGCAATCGCACGGTGCGCACTCGTACGTTGGTCGTGGGCTCTACGCGCTGCAGC
TCTCACTGTGGCTGCGCGTGTTTCCGCGCGAGCAGCTGCTGGTCGTGGACCTGGACGATATGAAGACTCCGGAGGGCACGCGGCGCGTGGCCAACGACGC
GTTTGCGTTTCTGGACGTGGCGCCGCACGCCGTGGCCGACACGGACCGCAAGAATACGCGCAAGTACGACGCTGTGGACGCCGCGACGGCGGAGCGGCTG
CGTACGTTTTATGCACCATTCAACGAGCAGCTCTTTGAGCTGTTGGGCCGTCGCTTCGATTGGTGAAAGCATTGTGGAGAGATGGATACATTTGGTCGAT
AAAAAGTACTTGAAGTAGATTAATAGGCTCTTGATTGTTTCGAGTGTGAGGAGTAATCAACTTGGAACTCATCAGGGCGATATATCCACATGCACCAGGC
GAGTGCGGCAAACGGCCGCAAAATCGAAGATACTGGCGACGACGCCACTGTCCAGCCACTATCCCCCAAAACCAACGCTGCTGCTCAGGAAGCTGAGAAA
CGCTGCCTTGGCTNNNNNNNNNNAACAAGTGTATATAATTGTTGGCTCTTGATCTTTTCAAGGCTGGAGTAACGCAGTGGGATATCAAGTTGCCACTCAT
GGCGGCGATATGTCCNNNNNNNNNNGAACCGGCAACAGCTCAGCATCGTGCGCTCTATACGACGCTTCGATGGATGCCACGTNNNNNNNNNNAAGGCTGA
CTGAGCTCGCGCGAACGGGCAGCAGCTCGCCATTGTACGCTTGATACGATGCATTGATGGATGCCACATCCAGCTCTTCGAACACATCCTCATTCACGAT
GATCTCCATACTGAAGGTGTGCATGCGCCGGTTCTTCGCTAACGCGCGTAGTCCGGCGTCCACCACTGCCANNNNNNNNNNGTGAGGCTCATCATAAAGA
TTTGCAAGCGCCGGTTCTTCGTCAACGCGCGGATTCCGGCATCCACCACCGCCATGACTCCGCCACGGTCTGTGTGGAGAGAAGCGGTGAGGCAGAGAAC
ACGGATGTGGACTGCCAGTGGGAGACTCACGTCGCCCAGAGCGTTGAGGCGTGTTGAGTCATGTGGATGGAGAGACTCGTCGCTTTGCAAACGCCGGAGG
TGTACCACTCGACAACAGCTTCCCCATCGACCTCAATGCCACCGTCCAGACTGAGTGCCTCAACGCGTGAGCAGCTTTCGNNNNNNNNNNCAGTCAGTGC
GGTGATGTGGAAAACACGAACGTGGGCTGCCAACGGGAGATTTTCGTCGCTGAGAGCGGTGAGAAAAGCCGGAACATCCTTAGTCATATCGACGGACAGA
CTCGTCGCTGTGCAGACGTCGGAGGTGTACCAAGCGACAACAGCTTCTCTAGTGACATCGCCGTCGTCGCCAACCAACGCCAGCGCCTCAATGCAAGGGC
ATCTCTCGAGGACACGTGGACACCAATCGTCCGACCACGAGCTTGGGGAGGTCACAGTGAACCCGCGCAGTCGTTCCCCCAAGAGCTGAAGCATCACGCC
TATTGGTTCCATTGACTCGGCTCCTACCTGTGAAGGAGCTGGTTGATCGGCACTGAATCGTTGTGTGCAACAGTCGGCATGTTATCCACTCGGTCACGCT
CGTGCAGCCACGCCTCCCCCTTGCCGGGCAGCAGCACGCGCCACCAGCCATCGGTAGGCATCGTGATCACCCGTACGGAGATTGGCGCTGGCGTGTGGAA
GACAGCCGTCGATGGATCGCGGNNNNNNNNNNGCTCCGGAGGTGTACCACTCGACAGCAGCTTCTCCATCGACCTCAATGCCCCCGTCCAGACTGAGTGT
CTCAACGCGTGAGCAGCTTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGACGGTCAAAAGCTGCACTCGTTCCCCTAGGAGCTGAAGCATCGAACCTGCGGGTTCCATTGACTCGGCTCCTAACTCTCTAACCTCCAC
ACGAATGCGATCGTTAATCGGTACTCGATCGTCACCTCCAACAGTCGGCACATCCTCCACTCGGTCGCGCTCGTGAAGCCACGCCTCACCCTTGCCAGAC
AGCAGCACGCGCCACCAGCCATCGGTAGGCATCGTAATTACACGCACAGGGATTGGTGCTGGCGTGCAAAGGACAGCCGTCGATGGATCGCCGAGGGCGG
GGTCAACGAGGCGAAAGGCTGACCCCCGTACGAATTCTGGGCGGCTCACTGCTGGCACTTCAAACAGCGCGGCGAGCGGATCTCCCGCCAGCGCAATATT
GCGCATGTCCGCTACATTTGCAATTGTAAGCGGAAAGTACTTGATAGAGAGACTGAGATTTCGCATGGCAGGATTCGCGTGACGACTGAGAAACACATAC
GCAAACCACCGCCACGCGGTTCTCTGATGGGCGGCGTCGACATCGTTCGCCAGAGGAGACTCGACGGTGGCATGGGTCAATGAGGCGCTGGCTTGGATTG
CTGACAGGAAGGATGCAACCGAGTCCGGAGGGTCCGAGACGCGGATTTTGACGTCCTGGAACGGTGCGACGGCAGGTTTGGCGTCGGGGCTGCCCAGCAC
GTGCGAGTGGTTGCCAGGCAGCGGTAGCGGCTCTTGCACAGTGGAACATGCCCATCGTACTACTTCGACTGTAGACACATTGGTGCCATCACCTTCTCCC
AGTTTTACGTTGAGCGCTGAGGCGACGACTTGCACTCCACACTGAGCTGCGTGGTGCATACAACGCAGCTCGTCGGTGGTCGCCACGGTCCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACTGAAGGGAGACGTGCGACCACAGCGAGTGGGCGTTGGCGCCGTTTGGGCTTTGCGATGTCTCT
CGTGGCGGGAAGAACTTCATGAAACGCACCAACGCACTCGACTTCTCGCGGGCATTCTCTTCGCTCGTGATACGAACCGAAAGCCGTGGACGTGACGCCC
CCGTGCTGGTGTCAGTCGTGCTTTCGTGTGTCGTTGCCTCTCCTTCCAGTCGCTCGCGAGCGCGTTGGTACTCATCCGAACACACAAAGGCACCCGTCTG
GAGCGCCTGCAGCAGCACGGCTGCTGGCTCCTTCCAACTACCACGAACTCTAAGGCTGACATGATCTCATGTGGCATGTTGCAGTCCTGAAGCACCGAGC
TCCACTCGCGGTCGCATTCCTTCGGCCAGATTCGCGTGAGTTCGCGGCGCCACGCGCCTGCATGCGTGTGGGCGAAAAGCATGAGCAAGTCGAGTGCCTC
GAAGAAAGGACCCAGCTCGCCAGGGTTCTTGGAGAAGATAACCCACAGGGTGCCGTCGGGATACATGTTTTGACTTGCGGTGAGCCGGCGAATGGTGTCG
TGCCACGGCAGCATGGGGAGCTTCATGTGTGGGTGGTCTGTATCTCCGTTGTCTCCGCGACTTGGTGAAGAATGCGAGAGTGAGAGAAGCGGAGAGAAGA
GGAACAACCAGCGACAGGGTTTGTTCTCGCCGCGGAAAGTGATACCAGTTCTCAAGGGTTCAACCACCTTCTCTCGCGACCTGAAAGCCCCAACCAACTC
GACCTTTCCCTAGTGGTACCACAGGAAGATGGCTACATTTGGTCGCTCNNNNNNNNNNTCAACCAACGCATCAAGCCCTCGACCTTTCCCTCGTGAGCAT
TTCTGCCAGTGGAACCACAGGCAGATGGCTACATTTGGTCGCTCAAGTAAAAAAAAGTGCCATTGTGCAGGCTTTTGACGGTGGTGTAACGAGTGCTCGC
ATAGGCACTTGAATAGCATGTGCACTTGGAAGTTCACACCACGACCAAGCTCACAGCGCGAGTGCGGCACGTGGCCGCAAAATCAAAGATGCTGGCGACC
GCATAACTGTCCAGCCACTGCCCTCCAGCGCCAACGCTGCTGCTCAGGACACTGAGGAACGCTGCCTTGGCTCGGAGGCCGACTGGACTCGCACAAGTCG
GCAGCAGCTCACCATCAAACGCTTTATATGATGCCTTGATGGATGTCACATCGAGCGCCCTGAACACGTCGCCATCCACAACGATGAACATACTGAAGGT
GTGCAAGCGCCGGTTGTTCTCCATCGCGTGGAGTCCGGCATCCACCACTGCCATGACTCCCCCACGGTCTGTGTGGAGACGAGCGCTGATGTGGAGATCA
CGAACGTGGGCTGCCAATGGGAGATCCTCGTCGCTGAGAGCGGTGAGAAGAACCGCAGCATTCTCAGTCACATCGATGGAAAGACTCGCAGCCTTGCAGA
CACCGGAGGTGTACCACTCGACAACGGCTCCCCCAGTGATGTCGCTGCCGCCGAACAACTTGAGCGCTTCAATGCGAGGACAGCTTTCGAGGACACGCCG
ACACCAACCGTCGTCCGACCACGAGCTTGAACCGGTAACGGTCAGCCCGCGTAGTCGCTCCCCCAAGAGCTGAAGCATCGCGCCTAGTGGTTCCATGGAC
GCGGCTCCTACATTTGTAACTACCATATGGAGGCGCTGGTTGATCGTCACTGGATCGTCACGTCCAATTGCCGGCATGCCCTCCACTCGGTCACGCTCGT
GCAGCCACGCCTCACCCTTGCCAGGCAGTAGTACGCGCCACCATCCATCGGTAGGCATCGTGATCACTCGCACGGAGATTGGTGCTCGCGTGCGCAGGAC
AGCCGTCGATGGATCGCGGAGGGCGGGGTCAACGAGACAAAAAGCTGACGCCCACACAAACTCTGGACGACTCACGGCTGGCACTTCGAACAGCGTGGCG
GGGGGATCTTCTGCCAGCGCAATGGCGAGGAGCCTCAAATTTTGCAGGCGTAAATGTCAGGCGATTCATGAGGAGGTCAAAATGCGTCACGGCGGGATTC
GCGTGACGGCTGAAAANNNNNNNNNNGGCAGGATTCGCGTGGCGGCTGAAAAGCACATATGCAATCCATCGCCACGCGGTCCGCTGACGGGCGGCGGCAA
CGTCGTCCGCCAAATGATAAAACCCGTAATCAAAGACGGTGATTAGCGGCAATGAGGCACTCCCGTGGACTCCCGATAGCAGAGCTGCAGTCGTGTCCGG
TGGANNNNNNNNNNCCGTTCTCCAATCGTGTGGTCCCGTGATCAAACACATTGATTTGCGTCAATGAGGCACTCGCATGGACTCCCGATAGCAGAGCTAC
AGTCGTGTCCGGTGGATCTAAGAACTCCATTCGAACCGACGTGAAGCAGTGGCTGCCTGGCACCGGCCGCGACTCTTCCGTCGTGGAGAGCGGTGGTGAG
CACGCCCAACGCACCGCCTCGACAGTGGACACGTTATTCAGGTCATCGGCATCCAGCATTACGCTGAGAAATGATGCCGTGACTTGCACAGCACACTGAT
CAGCATGGTGCAGAGCACGCAGNNNNNNNNNNAACAGTGGACACACTGCTCGCGTCATCGTCGCCCAGTCGGAGTTCTGAGGCGTTGACTTGGATTCCAC
ACTGAGCAGCATGGTGCAGAGCGCGCAGNNNNNNNNNNGAAATGCACAGAATCAATTGGCCTGTCCTTGCTGGTGAAACGCACTGAGAGCCATGGACGTG
AAGTCCCGCTGCGATTGCCGGCCGAGCTTCCACGAGTCGTTATCTCTCCTTCCAGTCGCCGTCGGACGCATTGGTGTTCGGCCGAACACACGTAGGCACC
AGTCTGGAGCGACTGCAGCAGCGCTGCTGCCGGCTCCTTCCAATCGCGACAAATTCTGAGTCTCACGCCGATCTCACGTGGCGTACTGAGGTCCCGAAGC
ACCGAGCACCTCTCGTGGTCGCTTTTCTCCGGCCAGATCTGCTTCAGTTCGCGTCACCACGCGTTTTCATTCGTGTGGGCGAGAAGCACGAGCAAGTCGA
GTGCCNNNNNNNNNNGGCCGGCTCCTTCCAATCGCGGTAAACTTTAAGCTCCACCCCGATCTGACGCGGCCCATCGCGGCTCCGAAGCACCGCCCACCAC
TCGTGGTCGCTTTTCTCCGGCCAGATCTGCTTCACTTCGTGTTCCCATGCGTCTTCTTCAGTGTGGGCGACAAGCACGAGCAAGTCGAGTGCCTCGAAGA
GTGGACCAAAGTCGCCAGGGCCCTTGAAGAAGGTGACCCACAGGGTGCCGTCGGAATCCACTGAACGTGTGGTGAGCTGCCGAAGGATGTCGCGCCAGGG
CAGCAACAGCATGGGGGGCCGCTTGCGTGATCTCTCCGTTGTTGGTGGTGAAGAATATGAAAGTGAATGACGAGGAGAGNNNNNNNNNNCAGAGGACCCA
GCTCACCCGGATCCTCGGAGAAGGTGACCCAGAGGGTGCCGTCGGATGCCACGTCTTGACTTGTGGTGAGCTGCCGAAGGATTTCGCGCCAAGGCTGGAG
CGACATTTGGGGCTCCTTGTGTATGTGGTTGGATCTGCTCGTTGTCGGTGGTAGAATTCGAAGTGAAAGAAGCGGAGAGACGAGCAGAAGACAGGGTTTG
TTCTCGCCGTCGAAAGTGGATATCAGTTCTGAAGGGTCTAATCAAAACGGTACTCCATGATTGCATTTCTCTTGGCACGTCTGCCAGGAGCTTCGCTGGT
CCCGCGGCACCGCGTACATGTGCCGATCGAGACCGTTGTGTCGTCAAGATCCACAGCGGACCGCTCGATTTATCCATAACGCGGTTCGCCTTCGACAAAT
GCGCGATCGTCGAGCCCAACAACGACTGCTTCCAGCGGTAGCCAGACGCGCTGCCGCAATCCCACCGCGCGCACTCATGCGCCGG