Description :
From Genome Similarity Track
Location :
contig_5:97746- 103516
Transcript NameFunction/comments
g1628.t1hypothetical protein
g1629.t1hypothetical protein
g1630.t1hypothetical protein
g1631.t1XP_009517271.1 hypothetical protein PHYSODRAFT_294930 [Phytophthora sojae

Sequence
5770 bases(100 bases per row)
ATACTGAACGGCACGTACGAAGCCCGCGGGACAAGTGATCCGATGATCGAGAGTGCCTACGCGTCCAGTGCTCCATTCTACGAATGGTTTGAGAATCAAC
TCGCCGACGGATCCCCGCTGCTCTACAACGACGCTGAGTCGTCTGCCAAGGCGCGTCTGCAAAGTGGGGCTGACCAAGGAGCAGACCACGCGTGGAGTCT
TTCCTACAAGGGCGTTGAGCAGTCAATGATGAGAATTGACGAGGAACTTCGTCGTCACGGTCCGTTTGACGTCGTCATCGGATTCTCCCAGGGTGCTGCG
CTGTTGACGATTTTGACTATGTGGTACTTGCACCATGGCAACGTGCGCTGGTGGAAGCTCGTGATCTGCGTCGGCGGAGTGGATGTGAGTGGCGTCAATG
TGAGGTCGCTGTTCCTGGACAAGCTGGGCAACCGCATGTCTGTGCCGATGCCTTCCATTCACCTAATTGGCAAGACAGACCCGCTTTACCACGAGTCGCA
CCGACTGGCGTTGTCGTGGGCGGACAAAGCGGATCCCAATGACTTTAACAAGTGGATTTACGAGCATGACGGCGGTCACAAGTTTCCGTCGGTATCGAGG
AACCGTGAGTTCTATGCGGAGTTGGGGTGTGCCATCAAGCAGCACTGTGGCAAGGGGGCCAAGACAGCTTCGGCCAGACTTTGAGCTCATTATGATATGG
GGTAGCACTGAACGTGTAGGCTTGCGCTGTACACTGATACGAAAGTACACGAAATGGGTGACGTTTAATACAACTGAGTCTTGCCATCGCATAAGGGAAG
AGGAATGGCGACCGAAGAGAGCGTATACAAAGAAAGCAACCAAGGTAGACCGTGCCAGAACGAACTGTGAGGCAGGTCGGACAATGCAAAATACTCAAAA
TCACATCAAAATGGACCTGCATTCATGAGCTCGATTACTACGAGCTGATTGCCACGACATTATCGTTCCTCGTAGTCGTTGCGTAGCAAGCCAATCGCTT
AAGCCGAGAGGTTGAGAGCTGTGCAGTTGGGCTGGAAACTCTCCGCCAGCTCCAGGACGTTGATCGAGACCGTTCCGAAGTTAATCACGCAGTCCGCCGG
ACCGAGGGCCAGGAGGTCAGCAATGAGTGAGTAGCAGTCCGCCGTCAGGCACATGAGCAGCACCTGGGCATCGGTGGGGTATGCCGTGGGCGGCACGAAC
GAGTAGCCTGACGCGGTCTGGCATGAGTCAAGGTATGGGTCCGCGGCGAGCTCCAGAAGCTTGGCAATCTCCGACGAGGGGCACACAGTAGTTTCGTCGT
AGGCGATGGTCTGCGTGGCAAAGCAAGTGACAGCGGCGGTGGCGGCGTAGGCGTAGGCGAAGGTCTTCATGGTCTTGGAAGGGGTGGAGGATGGCGAAGC
TGGTGTTGGAGCTTGGAGGAAGATTGGATAATGAGCTCCTGCCAGAGCCTCGAAACGGAGGTTGGTGCTCTAAGGCAGCATCGAAGGTGGGGGCCTCATC
TACCAGCTAAGTTGCATGGCGATAACGATGGCAAGCACTAGGGACACGTGCTGCGGCGGGCGCCGCTTCAACAAGGATGGTGTTCAGGAGAGGCGACTCA
CACGAAAGTGCGGCGTGGTTTTCCAACCAAGTCTCTTGACAACTGTGGCACAGCGTAAAGCTCGGGGCGAGCTTGCTGATCATGCAGACGCGGGCAGCTT
CAACTTGAGACCGTCCGTAACTGAGACCTTGCTTCCGCCGTTGCAGGCAGTGCTGACTCAAATTGGCTTGCAAAGCTAACTTACGTTCGAGATGAGCAAG
CGATCTCAATATGATTGCCGCAGTACGACCCCAGGCCATCTATCCTACCCAATTCACAGCCAAATCCTCGCCGACATCCCCGTGACCTGCAGCATTTCCG
GCGCTATCTTTGAGTCAGCGGAGCCCCCCCCCCCCACCCGACTGATCGTCCCGCCTCAAGTCCACACTGCCGTGATCAATCCGCAAGTACCCCGGCAAGG
ATATGTGTCGACTCGACCTTGACACTGTCGACCGCAACTGGAAGCAGCATTGTTCGTTTTCACGTCGACACCATCCGTGCTGGTGTTCGACTGTCGTGCG
GGAAAAGCTGTTCGCGTTGAAGTGCAAGGAAGCTGTTGAAGTTGGATTGTGTAGAGTTTGTGTATCAGAATACTCCACCTAATTGCGAATAACAAAAATC
TAATTGCTCTGCTGAGTATGCGTCACTTGCTGCTGTTCATGGGCCTGCCTTGCTCGACTGCACTTCACGTTGCCCCCTCCGTCATTGAAGTGCATAAAGT
TCAACAGCCACTACCTCCTCCAACAATTTCTGGTCCTCCTGCGTCGACGTCTCAGTCTCCATGCGACTTCGCACACCTACACCCTCGACGATATGCCGCT
TACCACCTTCCACCGCCAACGGACCAGTTCCCAGCGAGCATCACCATCGACGGAGTTTTGGGCGATAAAGTGTGGGTCGAGGTGCCTTGGAGCGAGTCTT
TCCAGGACATTCGAGGCCCAACGTTCTGGTCGCAGCCGTGGTTCACGACCAAGTTCAAGCTCCGTTACGACCAGCAGTTTCTCTACATTGGCGCCTACTT
GGAGGAGACCGAGGTGTGGGCCAATGTGTCAAAGCGCAACGATGTGGTTTTCCACGACAACGACTTCGAAGTGTTCGTGGATGCGGACGGGAGCACGCAC
AACTACAAAGAGTTCGAGCTAAACGCCCGAAACACGACCTGGAACCTCTGGCTCAACCGTCCGTACAGGGATGGCGGCCACGAGAACAGCACGCGAGTGG
ATCCACAACACGGGTTCGACATGCTGGACAGTGGCATGCAGGCTGCAGTGTTCGTCAAAGGCCGCATCAACGACCCATGTGCGTAGTGTGCAGTTTGAGA
CGCTCATGTCTGACATCGGGTAGCTCATGATCATGTTGATGTCACATTCTAGCCGAGCGTCTGCACTACTGGACTGTTGAAATTGCGTTGCCATTGGCAC
AACTTGCACTGCATTCGAAGGCACCAGTCCCCCCCGTCGAAAACTCATTCTGGCGCATCAACTTTTCTCGTGTCGAGTGGTCTGTTCGAGTCGTCACTGA
CGGCCTCACGGGGGGACAGCACTACGAAAAGAAGCCCGGCTTGAGTGAAGAAAACTGGGTGTGGAGCTCACAATACGCAGTGGATATGCACCGCCCAGAG
TGGTGGGGGTATCTTCAGTTCCGCCCGCAAGGCGAAAGTCCACCTGCGTTTGCTGAAGCGGTTGTGCCGCCTGATCCTGAGTGGGGTGTTCGGTATGTAA
GCTTTCAGTATTACTACGCGCAGCAAGCCTTTCATAACGCAACGGGGAGGTACACTCCTAGTCTGGAGCAACTACTTCCGTACTTCACTTCTCGTGAGGC
CATTCAGTGCACCAAGCTACTTGATGTCAGTACCACAAGTGAGTCGTTCAGTGCACAAATCGGGTTGAGAGAACACGCACTCGGCTCCGACGTTACCTCG
GCATTGGTTGCAAGCATCGAAAACGATGGATATATTTCGGTGGAGAACATGAGCTACACATCAGCCATTGCTGTGGCCGAGTAAGGCCAACCAACACCTG
CAAGACGATAGAAGACTTAACTGAAAATGACTGATATTTGAGTTTTTTACATGGCAGCTTCGCTGAAGCAACCCCACATACGTACAATCTCTCTCGCTTC
TCGTCTTCGTTACGCAAAATGCTTACGCGAAGTAGATCCACATGCTGAATGTGACGGCCAGAGCAGCGATGGCACTTCCAGCAACGAGAGCGTTGACCCA
CATAGGTTTGGTGAGCTCCGTGGCATCGAGCTTCAGGACCTTGTCCCAATGAATCATATACTTGCGGATTTCATCCGAGGGACGGCTCTTGTTCTGAGTC
AACAGACTCACCACGACGCATACGACCCCGGCAGTGACCCACAACAGCAGCGCAAAGTGCTGGAAGTTCATGTAGAAGAACGTATTCCAGATTCCAGGTA
GGTCGCCGTCCATGCTGTCGTCCTTGATCGTCACGAAGATAAGGCGCGAAAAACCGAGCAGACCGCCCACGATCATAGCCGAGAACGCTCCGTACACGTT
TGCCGGCTTCCATGCAACGCCAAGCACGAGCACAATACCGATAGGAGGCGTCAGGTAGCTCTGGATTTCAACGATCTGCTCGTAGAGACCCGTTCCGTTG
CGCATGATAGGGATCCAGCAGAAACTCAGGACGGCAAAGATGAGGATGCTCATGCGACCGACCCACACGAGCTGCTTGTGCGAAGCGTCCGGGCGGAACT
TGAGGTAGATGTCGTTGGTGACGACCGACGAACCAGCAGCAAACACGGACGCCAAGCTCGACATCATAGCCGTGATGATACTGGAGATCATGAGGCCAAT
AATGCCATGAGGCATCATTTCGGTGAGCAGGGTCGGGTACGCAGCGTCGGTGCCGTCCTCAATCTTGCTGAAGTCGAAGTAAATGCTGGCAATGATACCC
GGGATAACAATGAGGAACGGAGGGAGCACCTTGAGCATACTGGCGAACGAGCAACCAGCCTTAGCGTTGGCCGTGTCCTTCGCCGACAACACACGCTGCA
CAAGATCCTGATCCATGCACCAGTACCAGATTGAGCCTAAAGGCTGGCCGAAGATCATACCCGTCCACGGGTAGTCGGGGTCGTCCGTGGGCTTCCAGAG
GTGAAACCACCCTGAGCGGTCCTGGTTGTCCAGGTTCTCGCGGATGCCCTCAAAGCCACCGATTTGGTTCACCGAGTACGCGAACACAACGAGGCCACCC
AAAGTAAAGACACACATCTGGAACAGATCCGTGTACATCACTGCTCGAAGACCACCGGCAATGCTGTACATGGCACTGAGGGTAATGCAGACACCGGCAC
CGAGATACAGGTTCCAGCCCAACGTGGCCTGGAAAACGATAGCACCACCATAGATACTGGCACTCATTTTCGTCAACACGTACATGATGATCGTGATGAG
CGACAAGTAGTGACGGCACGGAGCACCAAAGCGGTACTCGAGATATTCCGGCGTCGTATACACACCGCAGCGGCGGTAAATGGGGGAGAAGATCCAGCCC
AAGCACAGGATCAAAATGGCAGCGTACCACTCGTACATGGCGACAGCAATGCCGCGGCGAGCACCATCACCGGCCATACCAATGAAGTGCTCGGCGCCAA
TGTTACTGGCGAACAACGCACCACCGACGAAGTACCATTGCATGCCGCGGTCGGCCAGGAAAAAGTTGGACACCTCGTTCATTTGGTGCTCTGGCCCGTC
ACGAGCAATGAGAGAGGCCGACGGACGCTGAGATGAGATTGCTGAGCCACGTTCGTCTCCGGGGGAGCTTCTTGCCCGGGGTGGGCTCCGAAGCCAGGTA
GCCGTCGCCGGGTGACTCGAGCACTTGGTCGTTGTTGCGTTTGGATCGTTTAATACAGGGAAAATACTTGGCCAAGTGACTCTCGCCTGCTTGGATGGAG
GCGATGACGGCCACGACCATCGTGAAGAACAGCACCGTCACAATGATGACGACGTCCCAAGCGTTAACTTTGGCGCCCCCGGAAGTGTCGGGCACCGTCT
GCGTGTACAGCTCGACCATGGCAAGGACTTGAACTCGACGAAGGTAGACTTGACTTGATACAGGGACCAAGAACGGAGGAGAGTCGCTCGCTCTCCAGGC
GGTGAATTGGATAATGAACTGAACTCGGGACGGTGGCGACAACAACGGTGGTGTCCATGGATGGCACCAC