Description :
From Genome Similarity Track
Location :
Scaffold_372:9774- 18196
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_372-snap-gene-0.7Intraflagellar Transport Protein 140
Pytiw_DAOMBR242034maker-piw_contig_372-snap-gene-0.8Intraflagellar Transport Protein 140
Pytiw_DAOMBR242034maker-piw_contig_372-snap-gene-0.9Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_372-fgenesh-gene-0.3Regulator of chromosome condensation (RCC1)

Sequence
8422 bases(100 bases per row)
GCGCTGTTCTACGACTACAATGTCCAGATTTCCTCCAACCATCGCCACGTGTGCTCCACGTGGGGGGAGACGGACCCGATCTTGGCAGTGGCGCTGGAAA
ACCGCGAGGTGCACTTCTTCACGGATGAAGTACGTACGCGGCGTTTAAAGATCTGCTCGTGCCGGAAGTGTTTGCTCTCTTGAAGCTGACTACACTGTGA
CCCTGCTCTGCAATTTGGTAGGGAGATAAAAGTCTCGGGTGCGATACGTATGCGCGAAGCGCTGATATCGTGACGATGGCCTGGCAGCCTCGTGGCGGTG
CACTTGCAATTGGCTGGAGCGATGGAAAGTAGTTGCTTGCTAGTTGCGAACGCGTCTATGCTCAATATTGTATTGACAATGTCTCACTTCCTTTGCAGGA
ATGGTGTCATTGTGGATTTGCAAGGAAAACTCAGCTCGAGAGGTGAACTCGCCGCACACCGGTCGCGTGGGGCTTCTCAAGTGGGCCCCAGCTGGAAACC
GACTCGTGTCGGCGGACGAGAACGGCGTCTGCGCCGTGTGGAAGGTCGACAGTCGCTCTCAGCTGTCGCTCAGCAAGTCGTACACGCGCCAGGGGAGTAT
CACGCATTGCGTGTTCGCAACAAGCCCAGCGCAACGCGAGAAGCTACTGAAAAGGTGAGCATGACCGCTTCGTTTCGACTCGGAAAAATCGGTTCTCTTT
CGCTAACACAAACTCTCGTGCTATCTTGTTAGTGACCATTTCTCGCAGCACGCGTGCCCGAAGTTCTTTTTCGGAGGCGAGATTGGATCGGTCCACTACG
CCGACGATCTGGACCACATCTCGGACATCCAAGTAATGAACCACGCAATCGACTCGATGATGTTCTACGAAGAGCTCAATCGGCTGATCGTGATCACGCG
AGCGCTGCAACTTAGCGTGTTCCAAGTCAGCGACACGGACGGAACTGTCAAGTCCACTTTCAAGGTGAAGCTCAGCGTCGCGGGAGATGGAAGTCTCCAC
GAGACACGGTGGGCAGGTCCCGGGTTACTCGCCATCGCGTCGGGAGAGCCGCTTGTTCGCTTTTGGGATATCAAAGCGGAAGAGAATAGCGTACTAAGCT
TGCCGAAGGCTGGAACTGCCAGCTACCAGGTCAACAGCATTGACTTCTCTCCACGTAAGCGCATTCTGGTCGCCGGGACCACGCAGGGCGTCGTTTTCTT
CTGGAGATGTGTGTCGCTCGCAGAAATGAAAGACGACAGCTCGTCAGTGTCGTATCGCTGGGACATCATCTTCACCACGGAGGTCGGGCGAAGCATCACG
CGGATTGGCTGGAGTCCCATCTACTCGACGCTCTACGCGAACACGTCTGAAGGCGTCGTGATTCTGCACGAAGGGAACATGCAGCGGGCTCTTTGTGGCG
ACACTGCGGTCATCCAAAGTCATCCGAAGGTTCTCTCCATCGAGAAGTATCGCGACGGCACTGTCACGCAGTCTACATTGGACACGACGCTCCCGATCAA
GGGTGTGTCGCACGATATCGCATCCGTGGTGATCTGGAGCGGGTCGAAAGCCGAAGTGTACGAGATCAAGGATGGCGAGAACAAGCGGATCGGTCAGTTC
AAGTGTGAGTCAAGCGCGCTCGTGGTTCGCGGCGACTCGATCTATCGCGCGAGCGGCAACCACGTCGAGATCTGCAACGTGCAGGGCGTCGTGAAGAACA
CGATCTCGTTCACTGAAGCGGAGGGGAAGCCAAGTCTGCTTTCGCTGCAGACCAAGTTCCTTGCCGTGGGTACGGACCAAGGCTTACTGCGCGTGTTTGA
CTTATCTCGTCGTGATCCGAAGGCAATGGGCAGCATGGGCAACTTTTTCGAGTCGTACGGAGATGAAACCCGGGCATCCATCATGCGCGCGATCGCAGTG
AATGCAGATGGGACGCGCGTTTGCATTCTCGCGGACAAACTGGAGGGCGCACTGAAGATTCGTGTGCCGCTGAACAAGCTTTTTCTGTTCCAGACAGACC
TCAATATCTTCCAGCAATACGACTTTGGTGCAAACAGGAGCCCCAACCTGGTGTTCTTCGATCCCAACGAGCCTCGCTTGCTAGCGTGTGAGACGTCGAA
GAGTAAAGCCGACGTGACGGGTGCTGGCACCCAGGCAACGGACCCCGCCGTTCGACGCGAAGGAGAGGAGTCGAATGCAAGTGCAGCGAACAACAACAAC
AACGCATCCCGCTCGTCGCTGTCTGACAAAGAGATCACGATCATGTTTGCCTCGAACGACCACGGACTACTGATGCAAGATAGCTTTGACTTGGAAATGA
GGTACAGTGCGCTCCTCGGCATCCAGGCACCACGCGTGTACTTCATCGCGCAGACAGAGAAGAGCTCCAGCGTCGATGCAACCACCGTGGTCAAGTGTGG
GAGCAGCAAGGAACGAACCAACAGCATCTCAAAGGCGTCCGCATCTAGCAACGAGCCATTCAGCTACCTATGCACCAAGATCATGCGCGACTTTGTCGGA
CTGGACAAGGTGGACGAGAAGGGACGCGAAGCACTCATCAACTTCTGCTACTACGTGACGATTGGCAACATGGACGAGGCGTATCGCTCCGTGAAGCTGA
TCGAGAACCCGTCCGTGTGGGAGAACATGGCGCACATGTGTGTCAAGACAAAGCGTGTAGACGTCGCTGAGGTGTGTCTGGGCAATATGGGCCACGCACG
AGGCGCTGCGGCTGTGAAGGAAGCAACGCTGCAGCCGCAGCTCGAGGTCCCCATCGCCATGGTCGCAATCCAACTCGGTCTGCGTGATGACGCTGCTCGG
CTGTACCGTGAGTGCGGTCGCTACGATTTGCTGAACAAGCTGTACCAGGCGAGTGGATATTGGCAAAAAGCAGTTGACGTCGCGGCGAAACGCGACCGCA
TCCATCTTAAAACGACGTACTATGCGATTGCGCAGCACTACGAAGAGATGGGCGACGTGAAGCAAGCCATGGAGGCGTACGAAGACGCTGGCACGCACCA
GAAGGACATCCCTCGAATGCTTTTCAAGATGGGGAAGCTCGACTTGCTGCAGAAGTACATCTCTACCTCCAAAGACCGCGACTTGATGGTCTGGTGGGCG
CAGTTCCAGGAAAGCCAGGGTCATTTCGATATCGCGATCGAGAGCTACGAGCGCGCCAAGGACTACCTCTCAATTGTTCGTGTGATGTGCTTCAAGAAGG
ACTTTCAAGGCGCCGCGAAAGTTGTCAAGACGAGTAGCAACCGCGCCGCGGCGTACCACCTCGCGCGCCAGTTTGAAGCCCACGAGGACATCCAGAGTGC
GATCCACTTCTTTGCCGCTGGCGGGTGCTACAATCACGCGATCCGTCTCGCGAAAGAGCATCGCATGGACGCGGACCTGATGAGCTTTGCTCTAATGAGC
AAGCCTAGCGACATGCTCGAGTGCGCCACGTACTTTGAAGAGCGGCGCGAGATGGAGAAGGCTGTGCAGCTGTACCACAAGGGCGGCAACGTCGCCAAGG
CGCTCGATATGTGCTTCCAAGCGCAGCTCTTTGAGGAGCTGCACCATCTGACGGACGAGCTGGGCACTTCCAACACGTCGCCCGCGATCCTTAAGAAGTG
CGCCGACTTCTTCATCACGAATGGCCACTTTGCAAAGGCCGTGCACTTGTGTCTGATCGGCAACCGCGTGAGCGAAGCCCTGGACGTGTGCATGCAGCAC
GGCGTCAAGGTGACGGAGGAAATGGCGGAGAAGATGACGCCGCCAAAGGACGACAAGGACACGGCGGCGGCGGGCGACAAGGTGCAGCAGAAGAAGCGCA
CCGACCTGCTGTTGAAACTCGCCAAGTGCTGCAAGAAGCAGGGCGCGTACCACTTGGCGACCAAGAAGTACACTCAGGCCGGCGACAAGCTCAAGGCGAT
GAAGTGTCTCCTCAAGTCGGGAGACACGGAGAAGGTCGTATTCTTCGCCAACGTCTCACGCAACAACGAGATCTTCATCCTCGCGGCCAACTACCTGCAG
AACCTGGACTGGCGCAAGGACCCCGAGATCATGAAGAATATTGTCGGTTTCTACACCAAGGCGCGCGGGTACGAGCAGCTCGCGGGCTTTTACTGCGCGT
GCGCCCAGGTGGAGATCGAGGAGTATCGAGACTACGAGAAGGCGATCGGCGCGGTCCAGGAGGCCGTGAAAGTGATCTCCAAGTCGCGCGCCGAATCCAA
GGACAAGGTGCTCAAGAACTACGAGACACGAATCCTGCTCATGGAGCAGTTCGTCGTCGCGCGGCAGCAGCTGCGCGAGAACCCGGACGAGATGGTCGAA
ATTGTCACGCGGCTGCTCGAGGAGCCAGGCATTGACGAGGCCATCCGTGTCGGAGACGCGTACGCCATGCTGGTCGAAGTGCACTATAGTCAAGGCGACA
TGAGCAAGAGCTTGGAGGTCATGGAGACCATGCGCCAGCGAGGACTGATGGTCAAGAGCTACGTCGACCCGCGCGTGATGCAGGACCTGCAGCAGAGGAT
GGGCGGCGGTGGTGCCTCGTCAGCGGGAGACAGTGACGACAAGCGCCGCCGGTCCGTGCAGAGCGATAACAAGATGGGAGTTGAGGACGATGGTGATCTC
ACGAGTCAGAAGAGGCCGACGACGTCCGGCGGACGTAAAGCCCGCCTCGACGACCAGAATGATGACGATGACATGGAGGAGGACATCGCAGAAGAGGACT
AAGCGAGCAGGGTGTGAGGATAAGAATGCTATTCAATGCCTGAATGTATGCATGAGTGAGTCTATGAACGTGTAAAATTTGCAATCTGATAACTCTTGTT
GGCTTGAAACGACACAACAGGTGACTCTTCACTCACGAAGACGGCACCCATGGTCCAAATGAAGTTGAGCATCTGCCTGTGCCGTCGCTTCAGATGAAGA
TAGCGCTCAAGCGAACTGATGCGTCACCACACGGCGAGCATGAGCCGCCCCACAGCGGCACACCCGCACACAGCACCACCAGCAGCAGGAGCCATGACGA
CGACCAGCAGACTGATGAGCAACTGTCACCACCACCGCCAGCACTCTCCGTCGAGGCGACCGCTATGCTCAATGCGCTTCCATGCGCCTCGACACCCTAC
CTCACGTGCTCGCGATGCAACAGCGTGACGTTCATCAACCTGCTGCGCGTGCGGCCGCGCGACCACGACAAGGACGAGACGCGGCTGGGCGAATACGAGC
AGCTTCCAATCTGCACGGGCTGCGGGAGCACAAAGTACCTGCGCGCCGGCGTCGTAAGCTTTCAGGAGAAGATCGCGGATGAGAAGCAAGCAATCAAGGA
GTTCGAGCGCAGGCGCGGGCCGGCCACGGTGCTCATCCAGCGGATCGCGCGCGGCTACCTGGGCCGCGTCGAGTTCCGGAGACGCAAGATCGAACGAGAG
CGGTACCTGCGCAAAATCAACAGGGCGACCACGCGCATCCAGACGCGCGTGCGGGGCATGCAGGCTCGCCGACGCTCAGTCATCGAGCGCTGCCTGCGAC
TCATCAGGCACATGCACGCCAGTGTGCTGAGCTACGCGCTCGCTGCGAGACCAGACAAGCCTCCAGTATTCTGGTACGAAAACCCAGCGGAGCGCAGCAT
CTTGTTCTGGAACTATCGCGAGTTCGTGCGCCGCTCGGGCGGCAAGCCCTCGCTCATCAAAATGGAGACGAACGTGCTCGAGATCACAAGGCGGATGCTG
ACACAGGAATACGTGCTCGTGAGCCGCATCCAGTCCCGCTGGCGAGGTATCACGACGCGTCTGGTGTTCCGAGAGTTCAAGCGCCAGAAGGGCTGGCTGC
GCGGCATTCAGCAGTCGCCCGCGATCAAAGTCCAGCGGCTCTTTCGCGGCCACACGAGCCGCAAGCAGTGCCGCGCGCTCAAGGTGACGAACCAGTACCC
GTCGCAGCTTGAAGCGTACCGCCAGACGCGTCTGGACCAACAGCAGCACGCCAAGCGCAAGGCGTTCCGGTCCAAGCTGCTCGGCAAGTACCGTCTCGAG
TACCAAGTGGACAAAACAACGCGCATGATGGCCTTGCAGGTCAGCACATCGGGTGCCAGACCCAGAGTCGGGCAGATGGTACACGACATGGACGATGAGA
TCGGCCCCGAGACCCGCTCGCATGTCCACCACTCGCTAAAGACGACTGGCTCCGTGACGCCAGCGGTTACAGCAGCAGCGACAGCGCCACGCTCAGGGAG
ACCCAATCTGCGAAGTGACGGCGTCGACGTCGCGCTCTCGAGCGTCTGTGAAGACACAGACGACAGCGACGAGCAGCAGCGCAGTGACGCTCCTGTGAGG
ACGAACCGCAACGTGAACAGCCAGCGCTTTGCCGAGATCAAGCGCCAGCTCGAGGGAAAGAAGAAGCTGAGTCTCCACCGGATCCGCGACCCGCGACTGC
ACATCCTCAAGGCGCAGCAGTACGCGCCGAACATCGCGTCGCCACTTAAACGGACCGACTCGTAGACGAACGAAAGTCCTTTGTGTCCATGTTCAATGTG
CACACACGTTTCTATTTCTATGTCTACCATTTATTTCTATTTCTATACGTCGGCTGAATGCGAATTGGCTCGTTTGGAAAAATTCATGGGGCATGCGCAT
TACAATCACTTGGTCACTTGCTTCTTCACGAGCAGCCAACCAGAGAGCAGACACCACAGGCGAGCGAGTCAACTCAAGACAAGATGCACGACTGCGCGAT
CGTCGCGTTCGGGTGCAACGACGACGGGCAGCTGGGCCGCGGCGAGAAGCGTCGCATGACGGGCCCCATTGATGACGTGTCCGCCGTGCACTTTCCGCAG
CAGATCGAGGAGCTCTTTGGCGTGGCCGTCGCGGCCGTGTCCTGTGGCTCGCGCCACACCATGGCGCTCACCACCAAGGGCGAAGTGTACACGTGGGGCT
GGGGAAACGTACGTATGCCTGTGTGTCTGTGGAAAGAGCGTTGGTAGTGTTTGTGGCGCTCCTGTCCAGTGATGTGCTCAGACGTGTTGCTGTTGATTTT
GTTGCAGATGGGCCAGCTCGGCCACGGCGACTTGAGGAGCTCGAGCGTGCCGCGGAAGATCGAGTTCTTTGCCGAGAACGGGCTCGAGGTCGACTACATC
TCGTGTGGTGGCTGCCACTCGGCGGCCGTGACGAAAGACGGTGAGTGGCGTGACATTTGCAGGGCCGCATCGCGAAAAGTCTCAACCTGCTGACTAAATG
ATAATGCTCGTTTGCTGCTGGTTGTAACAGGCACACTGTACATGTGGGGCGAGGCGCACTGGGGTCAGCTTGGCTTGCCAAAGGAGTTCCGGGATCTCCA
CCAGTCGTTGCCAGCGAAGTGCCCCGTGCTGCAGGATGGCAGCGAAGAGAAGATCGTCAAGATCAGCTGCGGTACGTCGTACGCATTGCCTTATATAGCA
ATCTAATCGATGTGTCCAGCTGACTGACTTGGTTATGCTGAATTAGGTGGCGCGCACACGGCTGCGTTGACGGACAAGGGTCACGTGTATATGTGGGGCC
GCTGCGACAATGGCCAGCTCGGCATCGGCCACGAATGGCTGCGTGACTCGGACGACGACGGCATGCTCGGCGTCAGCCGACCGCACCGCGTTGAAGGCTT
CAACGACGAGAAGGTGGCGCAGGTCGCCTGTGGTGCGTTCCACTCGGCTGCGGTGACCGAGTCTGGCCGTGTGTACATCTGGGGCAAGGAGGACTACGGC
ATGCTCGGTGTCGGCCAGACCTCGGACGTGCAGACGCCGCGTCGTATTGAGCTCTTCGACAAGACCCCTGCACTGTGAGTGACCTCTTGCGGATATGCAT
GAGGCGTGGTTTCTAATGGGGTTTTACTGTTGCTGTATTTTGCTTTTTAACAGGCGTGTGTCCTGCGGCGGATGGCACACGGTCGTGGTGACCAAGTCTG
GCGCCTGCTACTCGTTCGGGCGTGGCGAGTACGGTCGTTTGGGACTCGGAGACACCAGAAGTCGCTACCGACCACACCAGGTACGCTGGGTGCCCACTGT
GCTTTTCGCGATGTCTAGCGTTGTAACGTAACGCTTCTGTGTTGCTGCTGTTGCTATCTGCTGGGTATAGGTGGAAGCGTTGAAGGACAAGATCGTGGTC
CAGGCGGCCTGTGGCGGATCGCACACTCTTTTCCTCACAAAAGACGGCGTCGCCTACAGCTCTGGACGAGCAGAGTGAGTCATGGCTTGTTGTTGTGAAG
AGGGTTTAATTTTTACTGTTGGTGACTAAACTCTCGCAATGCTTGTGTGATTATCTGTAGCCACGGTCGCCTCGGAGACGAGGAGCTCAAGACGGTCATT
GTCCCCAAGGCACTCAACCTGGGCAAGCCTCCAGTGCGCCAAGTGTCTGCCGGTGGCGCGCACTCTGTCGCTCTGATGCATCCGTCCCTCGCTGCGCTTT
CTCCACTGCTGGCTCCGCTTCC