Description :
From Genome Similarity Track
Location :
Scaffold_1004:9774- 11417
Sequence
1643 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTTGGTCAATCCACGCCATCGCGGGTAGACTGCCTGAACCTCCGAAGTT
CGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGC
CTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTC
CGGCGGCGGGAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGA
AGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTA
CACTCGGGAAGCAACATCCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCCGAGCCGCGTTCCTCCGGCGAACTACGAGTACCGCCA
GCGTTCGCGCTTCCTCGCGTGTAAACAAGGAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCA
ACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTAGGCCCCGCACGCACCCAGCTGTTCCGGGTGCAGTCAAGCACCCTTGGAGAGGCGAT
TCAAGTGGCTCTTCAAGAAGTGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCC
AACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTACGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGG
AAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGAAACGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGGAACCAGTAGGGGCG
GGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACAGGGACTTAGCCCCTGAGAGTTTTCGCACTCTCAAATCGG
CGAAGCGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTCGC
ACGCCGCCAGACGGTTGCTCGCAGCAGCAACAAGTTGTCCGATGCTTTGATAGAAAGCAAGGGCAACGGGACGGTGTCAGTACGACTGGCCGACGGGAAG
GTCGTCACTGTCCCCAATGTCCAAGTGGATCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTTGATATAAATCCATATGATATGATCCTG
GGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTC
ATGCTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTG