Description :
From Genome Similarity Track
Location :
Scaffold_196:9773- 11255
Transcript NameFunction/comments
Sapdi_VS20SDRG_17094VPS15 protein kinase

Sequence
1482 bases(100 bases per row)
TGAGATGGAGCACCCGGTGGACGGCCCGCCGCCGACGGACGAGTCGGAGCACGTGGCCGAGACGCTCTTGTTGACGCAGGCCAAGTTTAGCGTGTACGCC
AAGCGCAAGCACGAGACGCTCAAGCGTATGAAGAAGGCGTCGATCAAGCCCAGCCCTCCGATTCGCGAAGAAGAGGCGTCGGTCAGTGGCGTCGACGACG
GCGACGTGTTGCCGGCCTCGGACGTCTCGACCCGGCCACCGCACTTGCCATCGCACCAAAACGGCATTATGATTATCCTCTCACTGCTCTGCTCGAGTGT
CCGGCACTGCGGTGTGCCCCAGTCCAAGCTCACTGCCCTGCAGCTCATTACGCGCCTTGGCGCGTTTGCCGACGACGAAGTCCGGCTCCAGCGGCTCGTG
CCATTCGTCATGGAGGTCCTCGACGATGCGTGTGCGGCCGTGCGCGCCGAAGCCATTCGCTGCGTCACGTCGCTCCTCTCGCTCGTCAAGATCTTTCCGC
TCTCGGACGCAGCGATCTTCCCGCAGTACATTTTGCCGGCGCTGCAGTCGTTCCCGTCGGACGCCGAAGAAATGGTCCGCATCGCGTTTGCCGAGTGCCT
TCCGTCGCTCGCCGAGTCGGCGCGGCGCTTCCTCGAGATCTCGTGCACGCTCAAGATGCGCGCGCTGCATGCGAATTCCGCGAACGCTACGTCGCTCGAG
TCGACGCGGCAGACCAAGAGCAAGACCAAGGACGGCAAGAACGGCGACGCAACGTTCTCGACGTTTGACGACGAGCTCAACCGGCTGCATCTGCTGGTCT
CGCGCTTTGTGATTCAGATCGCGGCGCCCGACCAAAAGGCCAGTTCGAGCCTCGTCAAGCGCGCGCTCTTGCACGACATTACGCGCCTGTGCATCTTTTT
TGGCCGCGAGCGCACGCTGGACGTGGTCTTGCCGCAGCTCATTACGTTCCTTAACGACCGCGACTGGCAGCTCCGCGCGACGTTCTTTGAGTTCATCACG
GGCGTGTGCTCGTTTGTCGGGCATGTGTCGGTCGAACTGTACATTCTGCCGTGCATTGAGCAAGCGCTCATCGACATTCAGGAGCTCGTGATTGCGCGCG
CGCTCCTCTGCCTCGCGAACCTCTGCGCGCTCGACATGTTTCAGCGCACGGCGCTGCTCGAGAAGGCCAAGCTCACGGCGCCGCTGCTTCTGCATCCGGG
CTGGTGGGTGCGCAGCGCGATCCTCAAGCTTCTCGCTGCGATCGCCAAAGAGATGGACGTTGTCGACCGCAATGTGTTTTTGGTGCCGCGCCTGCACCCG
TATCTGCGCAAGAAGGTGCGGCTGTGCAAGGACGACGACGTGGCGCTCGTGTTGCGGGACGCGCTCCGGCCGCACGTCTCGCGCGAAGCCTTTGACGCGG
CGCTCATGGCGCGGAATGGCCCGCGCCTCTTGTTGCACGACGCAGCAGCCGACGACACGGACGACGAGACGAGTATGAGCAA